Science method
Polymerase Chain Reaction - Science method
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Questions related to Polymerase Chain Reaction
Hi everybody,
I have tried to make my home-made master mix for our laboratory. I have used two type of dyes , cresol red and Bromophenol Blue(BPB). I see when I use BPB my PCR is inhibited but no inhibition is observed for cresol red.
Have anyone had the same experience? Do you think the pH of BPB need to be adjusted before use? when I add BPB to my colourless master mix in the proper concentraion it return to blue so I think pH readjustment of master mix buffer is not needed. How do you think ?
Hi!
I am to site-specifically label dsDNA parts using PCR with fluorescently labeled primers. For my objective it would be optimal if the primers could carry the fluorophore as close to their 3'-end as possible, preferably exactly at the 3'-end. I am worried however that perhaps this would prevent the polymerase's ability to elongate during PCR.
I have seen others label the primers as close as 1 position upstream of the 3'-end e.g. in:
Nazarenko I, Lowe B, Darfler M, Ikonomi P, Schuster D, Rashtchian A. Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Res. 2002 May 1;30(9):e37. doi: 10.1093/nar/30.9.e37. PMID: 11972352; PMCID: PMC113860.
Can DNA polymerase elongate if the 3'-end of the primer is modified with a fluorescent tag?
Thankful for any input!
All the best,
Niklas Eckert Elfving
Uppsala University
My fellow Academic colleagues!
I together with my lab mates have a PCR-related issues that we hope that some(one) of you might have encountered and hopefully solved.
In “short”, our initial PCR (MiniAmp Plus thermocycler) and electrophoresis protocol works like a charm – the latter somewhat modified. We obtain weak to strong band that yielding concentrations of 9 to 20 ng/µl following clean-up using the QIAGEN QIAquick PCR (& Gel) purification/Cleanup Kit (with an acceptable A260/A280 ratio). We obtain rarely, but from time to time, a positive electrophoresis confirmation. But as we are using the same protocol for the confirmation, as for our initial PCR, we should have no issue confirming our results (one band per week).
Usually, when we try to confirm our cut-out electrophoresis bands, running a PCR on our cDNA, something fails. We utilize the same primers and protocol, as for the initial PCR, but nothing shows up in our gel, our at best a streak. We’ve tried renewing our primer mix(s), new isopropanol, new buffers, using both RNAse-free water and the included buffer, modifying temperatures (thermocycler), number of cycles, and using the original non-modified protocol. But nothing results in an electrophoresis band when we try to confirm our initial band.
Thank you for your insights and help!
// Eriksson et al.
I am running a DNA PAGE after PCR (samples 6-15 are run in duplicate with the second sample digested) to determine serotonin genotypes. The ladder (well 1) is on the far right of the attached image). I would greatly appreciate any advice on how to enhance band brightness and definition, thanks.
Additional information: 5 uL ladder added, 10 uL PCR product per well, PH of the buffer is correct. Temperature of the room ~75F with Gel container NOT on ice.
I want to do PCR amplification with my full-length gene and the addition of P2A fragment at the end of my gene. However after doing PCR, I run gel electrophoresis for analysis. But it doesn't include the band for my gene. I run the same template DNA with other primers for smaller fragment, and it has the band. I tried to redesign my primers for full-length fragment, but it still don't have the band for my gene. Can anyone help me? Thank you
Hello.
I have a problem with our in-house designed rt PCR for Cutibacterium acnes. Primers and probes were designed as part of mPCR. While testing each set of primers (monoplex) for LOD we are constantly getting false positive negative control. We repeated reaction many times. We change all reagents for new (to exclude contaminated reagents) and still the negative control in late positive in around 38 Ct. We tested negative control with 16S PCR and was negative. I was thinking to set a Cutoff/threshold? Does anybody has experiance with setting it? Thank you.
Anja
I use a Q5 polymerase to amplify a 7 kb fragment from a genomic DNA but get no results.
I use the stated protocol in NEB website. Any suggestions to modify the PCR protocol so I can get the amplification?
I have the PCR products of two bacterial genes (gyrA=1024 bp and rpoB=808 bp) and I want to know how many microliters I should add in the agarose gel?.
Which of this techniques can give us the best result in detection of chromosomal abnormalities
Hello,
Please is goat genome not listed on UCSC In-Silico PCR website?
Please could someone assist on what to do if working with goat
Thank you
when I insert my primers in primer blast site and push the button "get primers" I just reach different errors and I don't know what the problem is!
Hi all
earlier I have seen in some papers people go for DNA extraction and normal PCR using 16S rRNA primers for the identification of bacteria. However recently I have seen few papers particularly dealing with Uncultured “Candidatus” bacteria, researchers go for RNA extraction, reverse transcription RT-PCR and real-time RT-PCR ? Molecular biology experts can you please tell me …..
1. what’s the key advantage between the two ? is there any particular advantage of RT PCR for the identification of Uncultured “Candidatus” bacteria ?
2. Is it because of the possibility of “relative quantification” of the bacterium by real-time RT-PCR by targeting the 16S rRNA gene of the bacterium?
3. Is there any advantage when (RT PCR) used for uncultivable bacteria?
4. what is this Cycle threshold ? what is the significance of this in the above reaction ?
5. Also “The eukaryotic elongation factor 1 alpha from the host was used as a control of the RNA amount, and a good extraction was expected to give a Ct-value around 15 (the cycle threshold was set to 0.1). ? all results with Ct-values above 45 were considered negative !, what does it all mean?
My aim is just to identify the unculturable bacteria from tissues! Can I go for just normal PCR (16s rDNA) and sequencing the PCR products? Please
thank you
regards,
I'm having trouble obtaining clear PCR bands for DNA fragments ranging from 907 bp to 655 bp. I've tried various methods, including:
- Testing different brands of Taq DNA polymerase (Takara, NEB, Vivantis, HF Pfu DNA pol).
- Using the appropriate buffer each time.
- Isolating fresh plant DNA using the CTAB method, followed by RNase treatment, ensures the template DNA concentration is not less than 100 bp (800ng/ul - 1500 ng/ul).
- Initially, conducting gradient PCR to determine the optimal annealing temperature in the range of 51 to 60 degrees Celsius.
- Using a new vial of primers (taken from stock primers).
- Running a positive control (Actin gene, 250 bp) alongside the PCR reactions. However, no amplification was observed in the positive control, with only smear and faint bands detected in some plant samples.
- Conducting in silico testing of the primers, which indicated they should work correctly.
Please provide suggestions on how I can obtain clear PCR bands for my products.
I am performing PCR as a QC test to look for a transcription gene that should be negative after a CAR T therapy process. As we are comparing against a CAR transduced patient's cell, we require a used transduced ATCC cells. However, the ATCC cells have a low transfection titer, which makes the PCR band faint and when kept for long, it becomes fainter and fainter.
I was thinking of using another different grade of cells such as transduced research grade cells as it was observed that the bands tend to be much brighter than the ATCC grade cells.
Is it possible to use transduced research grade cells instead of ATCC grade?
I ran PCR using COI universal primers on DNA extracted from lice.
I added 25ul of 2x master mix, 5ul template, and 1ul each of 20uM F and R primers, with the remaining volume made up with DW to a total volume of 48ul, and ran PCR including a control group. However, no bands appeared on the gel after electrophoresis.
I then checked with a nanodrop, and all 5 PCR samples (including the control group) showed concentrations around 20000ng/ul, with A260 readings around 400, 260/230 ratios around 10-11, and 260/280 ratios around 37-47.
Where could I have gone wrong?
I would appreciate input from experienced individuals.
Hello,
Since a large part of my budget will go on NGS and I don't have the money to repeat it, I want to make sure that it will work.
The PCR products look good on the gel (nice bands of the expected length), but I was also wondering whether it's feasible to send a few samples for Sanger Sequencing to verify the product, before I spend all my money of an Illumina run.
Thanks :)
Dear Team Fungi,
We would like to identify root fungi from Vitis vinefera via metabarcoding. The methodology is established, we have had good results with other root samples using the isolation kit 'innuPREP DNA/RNA MiniKit' and the standard primers gITS7ngs/ITS4ngs with 49 °C annealing temperature. Unfortunately, we do not get any bands from Vitis roots, no matter what we try (e.g, adding BSA or a temperature gradient). Does anyone have any ideas on how to modify the DNA isolation or PCR to eliminate the potential interfering substance in Vitis roots? There must be something in there that interferes with the PCR...
With desperate regards
Kai
I want to copy a target gene from cDNA into a plasmid. The primers were designed according to the CDS sequence from NCBI. But when I performed PCR reactions I could not get any target bands. So the CDS sequence was synthesized into my plasmid vector. When used the plasmid as template and the above primers to run PCR, target bands were quite clear which means the primers can work. I know the gene copy number in plasmid must be much higher than in cDNA. So I increased the amount of cDNA template and cycle numbers (from 35 to 45 cycles), no target bands showed. Could anyone tell me what the problem might be. Is that possible that the CDS sequence in my cells has changed? If yes, is there any other ways to get the CDS sequence except artificial synthesis.
I am trying to amplify my gene for cloning. The desired PCR product is 2652 bp. The Tm for forward and reverse primers is 68.4 C and 61.3 C respectively. The annealing temp I set was 60 C. These are the results I got. How do I reduce nonspecific binding of primers? What can I do to increase primer specificity? Is the high difference in primer Tms affecting my PCR?
We run Fungal Panel using Molecular PCR Technique. We extract Nuclease Free water in the same way as we extract the sample. This eluted NFW is used as negative control on our PCR Plate for quality assurance. If we need to store this eluted sample for about a week, should we store it in the refrigerator (2-8 C) or Freezer (-20 C)?
How to identify sizes fragments of ZWF1 PCR product.
Maybe someone knows why this happens. The situation is that after PCR purification of gel products (cut one band), on the next electrophoresis, instead of one band, two bands appeared, how could this happen?
I used the Intact Genomics FastAmp® Plant Direct PCR kit and when seeding the gel with the PCR product there was a lot of DTT smell. After running the gel, partially degraded dna was observed, even in the molecular weight marker. Could it be possible that DTT diffuses into the gel and degrades the DNA?
I am trying to use the overlap extension PCR to combine two linear fragments of approximately 1200 base pairs in size. My first SOE-PCR was successful using Taq polymerase, with annealing and overlap temperatures set at 60 degrees Celsius. It had smear with my desired sharp bond. after that when I trying to repeat the process, I only obtained a smear with no specific bonds.
I amplified my fragments with taq and also pfu, but I don’t get my desired bond. I had just smear.
Does anyone have such experiment and help me, please?
Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line.
I'm using a multi-sgRNAs technique to increase my chances of a significant deletion. I isolated 4 clones of interest which share a similar trait: they all show 3 different bands after PCR amplification an electrophoresis on agarose gel. This is not so much a concern, since it was one of the expected outcome (the CRISPR/Cas9 system can create three different cutting pattern, resulting in 3 different bands). FYI, the 3 bands are all different in size from the WT band (with the top band being around 100 bp bigger than the bottom lane).
I ran again the sample on a more concentrated agarose gel (2%) with a lower voltage to get nice bands and being able to cut them. I extracted DNA from each band and re-run a PCR on each of them to increase my DNA material. For all my 4 clones, the bottom band amplify to a nice and single band corresponding in size. However, the middle and top lane display the 3 bands again, and it doesn't make sense to me. Indeed, I could understand finding the middle band in the top band sample, or the other way around. But I would have never expected finding the bottom band in the top band sample, because the top and bottom band are clearly separated and shouldn't contaminate each other.
I made a mistake by not using sterile instruments to excise my bands, which could explain in part some contamination. However, if it was this issue, I should have multiple bands in the bottoms sample, which I don't have, and I should have cross-contamination through all the sample, which is not the case. I'm pretty lost so if someone has any idea, I would take the advice with gratitude.
(I attached the gel picture from where I extracted the bands (small gel) and the re-run PCR gel whit the unexplained bands. On the gel, T= Top band; M= Middle band; B= Bottom band).
Thank you all!!
Is it possible to conduct PCR to check for resistant genes in bacteria and have no bands? All have bacteria have no bands of the resistant genes
Hi everyone,
I'm in the process of creating a zebrafish Knock-in line. In order to verifying that my integration has worked, I've created a positive control plasmid with the fragment that I would expect to have in my transgenic line.
Typically, using plasmids as a positive control for PCR reactions would yield single bands due to the purity of the plasmid. My concern is that, once I optimise my PCR using the plasmid, the PCR might not actually work when using extracted gDNA from zebrafish as the template. Hence, I was wondering if it is sensible to mix the plasmid with wild type gDNA to create an unpure template. I could then use it to optimise my PCR reaction. Does this sound feasible?
Thanks :)
I am trying to stitch in a 38 amino acid tag to the N-terminal end of my protein (3200bp) to be cloned into a lentiviral vector (~7000bp). The forward primer for the same, along with the overhang and the restriction site, comes about 150bp long. The first round of amplication gives me a band close to about 3000-3500bp along with a lot of other non specific bands at the higher molecular weight range. I then gel elute this specific band and reamplify using it as a template with the same primers but i end up getting a smear on the gel. I have also tried using this gel eluted sample to proceed with the digestion and ligation with my vector but in vain.
My PCR parameters are as follows:
1. 98 degC- 2min
2. 98 degC- 10s
3. 65 degC- 30s (2-4: x25 cycles)
4. 72 degC- 2min
5. 72 degC- 5min
6. 4 degC- hold
I use Q5 polymerase (strangely, I do not get any amplification with Phusion). I have tried a gradient PCR and it generally works in the range of (58-68 degC). I use about 50ng of the plasmid template for amplification. I understand that really long primers hamper the quality of amplification but unfortunately, this is a necessity right now.
I would really appreciate if anyone with experience can help me out here. My molecular biology is not THAT strong so please point out if I am committing any obvious mistakes.
Thanks in advance!
I ran the agarose gel and cut the right band, then put it to -20C, I performed PCR purification next day, but there were two bands. After two days, I ran the gel, the PCR products were almost degraded. Anyone could help me? Thank you so much.
Hi everyone,
I've been struggling doing PCR for fungi using ITS1F/ITS2R. My positive control (yeast DNA) worked well. My templates gave faint or no band. It sounds like my templates have inhibition but the 1 6S PCR worked very well for all of my templates. Also when I switched to fITS7bF/ITS4NGSR, PCR works for all of my templates as well.
I analyzed this pair of primers and found that they can formed self-dimer and primer dimer. So I've been trying many methods from increase annealing temperature, reduce primer concentration, touch down PCR, adding BSA, DMSO, increase denature time, even increase number of cycle to 40 cycles. But none of these really helps. I use Q5 hot start master mix.
Any suggestion please!
Thank you so much!
Hanh
I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009 (GRCh37/hg19)]. Is there any clue? Thanks.
I tested gene expression by RT PCR followed by Western blotting to test protein expression. I get an inverse correlation with up-regulation at mRNA level and down-regulation at the protein level. What could be the reason. Please suggest.
Hi All,
I am trying to amplify mitochondrial 16S gene for marine snails (Calliostomatidae) and other vetigastropods, but I only get primer dimers or nothing on the gel. These primers have worked previously in my lab and in numerous other publications. The DNA concentrations are low, but they have amplified for COX1 using the Folmer universal primers.
I am using the Palumbi 16S universal primers (Forward: CGCCTGTTTATCAAAAACAT and Reverse: CCGGTCTGAACTCAGATCACGT). We bought new primers in December 2023. I resuspended them and have tried multiple aliquots. I've tried gradients 45-55 and 55-65 and a touchdown PCR starting at 59 (-1 C/cycle for 10 cycles) and final annealing at 48 for 20 cycles. I've tried the standard, ammonium, and combination 10x buffers. All reagents are from Apex (not a hot start taq), except for the dNTPs.
Our usual protocol is: 2.5 uL of 10x standard buffer, 1.25 uL of MgCl2 (50mM), 0.5 uL of dNTPs (10mM), 1 uL of both primers (10uM), 0.2 uL of taq (5 units), and 2 uL of DNA. This does work for Folmer. Denaturation at 95 C for 4 min, 35 cycles of 95C for 30 seconds, 50C for 30 seconds, and 72C for 30 seconds, and final extension at 72 for 10 min.
I'm desperate and would love to hear any suggestions/tips on how to fix this!! I also unsuccessfully tried ethanol precipitation to increase the DNA concentrations, so tips on that would be appreciated too. Thank you
I am doing microvolume extraction which include physical( freeeze and thaw) and chemical lysis followed by a pcr base metagenomic library prep. My samples contain phytoplankton cultures with their microbiome. The mthod worked for most samples and timepoints but did not work for samples of one timepoint with high loads of phytoplankton and bacteria. I tried 3X dilution for direct PCR , bead-clean up and 3X dilution of sample and then bead-cleanup in case some inhibitors were hindering.
Looking forward for your scientific advice!
Thanks.
Greetings to all!!
DNA is isolated from infected cotton leaf.
The image is attached. It looks kind of shearing.
What are possibilities to use it for PCR?
I am looking for help to optimize a nested PCR from Long Range (LR) PCR (DNA as template). The LR PCR product looks spesific on agarose gel. We have tried various dilutions of this product as template, but keep getting a couple of unspesific bands on the gel in addition to the expected product (the unspesific bands are a little larger in size than the expected product). When we add genomic DNA instead of the diluted LR PCR product, using the same polymerase and conditions, we get clean product of the correct size. What could be the cause of the unspesific bands? Is it necessary to clean up the LR PCR product before using it as template for nested PCR when we dilute it (1:50, 1:100, 1:1000)?
Hello all, I have a query in resolving close products in agarose gel electrophoresis: I have three different expected products in my samples: 460bp, 480bp (only in mutation), 323bp, and I run them in a 3.2% TBE agarose gel, thickness 0.75cm, running conditions: 75V, at 4degreeC, for rough 8hrs with paused interruptions for detection every 2 hrs. What I see is that I have a definite signal at 323bp and 460 bp, then between 500-600 bps I have various other products (picture here after 8hr 10mins). I had cut the band, eluted the DNA and Sanger sequenced the products, turns out the band at 500bp is the same as 461bps and the band at 550bps is the same as the 323bps. The band at 460bps of the mutants, is a mixed signal in the middle of the Sanger sequence, where I could see that it has the sequence of the 323bps and the 480bps with the main 460bp sequence.
With the a second PCR of same settings and cdna, I run the sample with 3.2% agarose in TBE, reduced the thickness to 0.5cm this time, run it for 2 hrs in 150V, then further at 25V for 12hrs at room temperature. Here I do not see, multiple products between 500-600bps but one single product around 800bps. Can PCR products heteromerise when they run through a high % agarose gel?
I would like to resolve the products, but still avoid the poor resolution of some portion of the products, in the agarose gel. I am using the biozym LE agarose. any suggestions to improve for this experiment please?
Hello,
I am currently attempting to obtain amplifications of SoxC from a species of onychophoran belonging to the Peripatidae family using primers designed from a sequence of its sister family, Peripatopsidae. The sample I am using is cDNA, and I have tried different concentrations of reagents and cycling times in the thermocycler. However, I have not obtained any amplification yet.
I would like to ask how you would start standardizing reagent concentrations and the thermocycler program for a set of primers generated from the sequence of another species for a conserved gene like SoxC (700 bp amplicon).
I have COI as positive, and before using any cDNA for SoxC, COI was amplified.
Due to resource optimization, the primers I use for SoxC had to be initially designed with the sequences of the promoters SP6 and T7.
So these are my primers:
SoxC-F5: ACGCCAAGCTATTTAGGTGACACTATAGGCGGCTACGGATCTTACACA
SoxC-R5: CAGTGAATTGTAATACGACTCACTATAGGGGGGAAATCAAAGTGCGAGCC
none exceed 50% CG.
Additionally, I am conducting tests with cDNA extracted from different tissues and stages to increase the likelihood of finding my sequence, but I still fail to obtain amplification.
Hi everyone, I'm doing PCR for mycoplasma detection I'm using the primers GPO-3 and MGSO; the denaturation, annealing, and elongation temperatures and times were 95oC for 2min, 95oC for 30s, 57oC for 45s, 72oC for 1min, 72oC for 7min, for 40 cycles. The results were analized by gel electrophoresis using 1.5% agarose.
A band in 270pb is a positive result, but in some samples a band is amplified in 200pb. I was suggested that this band could be interpreted as a positive result for a different mycoplasma genus.
Polymerase Chain Reaction (PCR) testing is a molecular biology technique used to amplify and analyze DNA or RNA samples. So, To perform PCR testing, which list of laboratory apparatus and equipment is required?
I am trying to check the homozygous mutant for Arabidopsis (seeds ordered from ABRC). I have done genomic DNA extraction, using Edward's method and checked the it in agarose, the genomic DNA is there. And also I got quite a good concentration of about 1ug/ul. I designed primers using SIGnal primers design against the salk ids, but my PCR is not working. I have tried different temperatures and polymerases.i have kept the 1st denaturation time about 10 min, and checked the primers, its interacting fine with the genomic DNA using clustal omega. where am I doing wrong?
I have a question for the professionals. The essence of the problem: I fix the oligos on a plastic substrate, they play role of primers in solid-phase PCR. I carry out a one-step PCR with simultaneous labeling of the product with biotin (I add 10% labeled uridine to unlabeled T to the DNTP mixture), then I wash it in PBS and incubate it with the streptavidin-peroxidase complex and then incubate it with the substrate for peroxidase. Everything would be fine, but in the control wells, where the PCR reaction mixturedoes not contain DNA, I have a staining of oligo spots, weaker than in the experimental wells, but it is there. Moreover, in the control wells, where only PBS was added, weak staining also appears at the localization spots of the oligos. If I simply add the complex to the wells (without any PCR treatmen), then only the positive control points, that is, the initially labeled oliagos, are stained in them. So here's the question. Can streptavidin (or peroxidase) bind to something other than biotin or DNA oligos? I’ve been fighting with the problem for a couple of months now. I 've changed blocking buffers, polymerases, washing modes, but the result is still the same. Help, good people!
The Quantstudio 3 qPCR machine works really well with low-ROX SYBR premix PCR, I just concern about whether it can work in high-ROX premix or no-ROX premix? In the software, the reference dye can be chose as ROX or none, etc, but not having options like low-ROX or high-ROX?
ChatGPT claims that the following general invertebrate primers are often used for nematode barcoding:
- Forward Primer: JB3: 5'-TTTTTTGGGCATCCTGAGGTTTAT-3'
- Reverse Primer: HCO2198: 5'-TAAACTTCAGGGTGACCAAAAAATCA-3'
Having problems with dimers and an answer from Paul Rutland for another question made me think that the fact that I store my PCR mix in the fridge might be the problem. I must add that in this mix I add both primers, so maybe dimers are being formed prior to the reaction during storage. Does this make sense?
Bands are appearing very, very faint! I presume low DNA in gel, but my DNA concentration is over 1ug/ul. This is after my overnight digestion. I used a MaxiPrep protocol to extract DNA from Bacteria culture. (I inoculated from my glycerol stock and extracted the DNA after a MaxiPrep).
My DNA (pUH-dnvamp2-iGluSnFR) seems to show clear band digestion on the gel and accurate band size. My other plasmid (pUH-iGluSnFR) seems to show very faintly on the gel after digesting the extracted DNA plasmid. I screened my glycerol stocks and with a MiniPrep and found one that showed my genes. I proceeded to do a Maxi Prep with that clone. My concentration for this DNA was 1349.3ng/ul, and the A260/A280 was 1.9. I have repeated this digestion multiple times. Yet, the gel run after the Maxi is very low.
I am about to run a PCR, assuming that any little DNA present will be amplified to confirm my genes of interest. My purpose, in the end, is to utilize the plasmid for virus production. Hence, a high DNA conc. is important for high virus yield.
Any help troubleshooting will be appreciated. (Pictures: first one is Gel after MiniPrep, second one is gel after MaxiPrep
I am working with an allergen and i am working using PCR, the result that offers the kit is copies DNA, although i need to give a result in mg/kg. Is any possible way?
Thank you in advance,
Kiriakos
I have ran a gel to determine DNA products with the following base pairs, 745
590, 317 and 825. However, I got bands just below the ladder, my negative control came out negative and I do not know what conditions to change to address this.
Hi all. I have some primer pairs which always produce those horrible primer dimer bright smear! Increasing annealing temperature does not solve the problem. Any suggestiopn for a PCR enhancer or another strategy? So far I have used DTT and DMSO and amplification quality still poor! Thanks
Hello,
I am interested in performing genomic DNA extractions and subsequent PCR analysis on some human cells (HEK293T). However, I am thinking of using a "colony PCR", i.e., by taking a number of cells and putting them into the PCR conditions and hoping that the initial denaturation temperature at 95℃ is enough to lyse the cells and release the genomic DNA.
Is this possible to be done? Has anyone attempted this, and if they have succeeded, how many cells are required and what are the parameters of the PCR conditions?
Thank you very much in advance!
I designed a primer for gene sequence(1480 bp) and when carried PCR, the product was 150 bp, what is the problem? and how to obtain the correct fragment?
After transformation in DH5 alpha, I got positive colonies. I have confirmed it by PCR (using an isolated plasmid of positive colonies as a template to run PCR by Takara Taq) and restriction digestion. In PCR, I got exactly the same size of band as my desired interest in the gene but did not get fall out of my gene in restriction digestion.
I have attached a gel pic of PCR and restriction digested . 20 ul of restriction digestion was put at different amount of plasmid ( 5 ul and 8 ul of 140 (C1 )and 305 ng/ul (C2 )
hey I really need an urgent help
I'm so confused with the primer sequence of 1492R.
some journals said that 1492R is GGTTACCTTGTTACGACTT (and I use this as my PCR)
but the research company that will help me sequence my bacteria said that 1492R is TACGGYTACCTTGTTACGACTT
I need this answer as soon as possible because I have to send my PCR product to sequence service, thank you
Hi ResearchGate community,
I have been trying to learn more about the optical differences between block-based real-time PCR machines like ABI StepOne versus rotor-based machines such as MIC or RotorGene systems.
I understand that some systems rely on ROX as a passive reference dye while others state that it is optional to incorporate it and others do not need such a factor at all.
My question is if you add this fluorescent dye to your master mix, would it interfere with the detection when it is being amplified using one of the systems that do not need such normalization?
Highly appreciate any insight in this regard.
Best,
Negar
I am amplifying target sequence 450 bp. I get single sharp band in the control and faint in sample with another sharp nonspecific product. why?
I need to get one single band from my sample to sequence the target . what should I change?
I changed annealing and DNA concentration, time of each cycle and used different PCR master mixes.
Hey everyone,
my question is maybe strange at first glance, but simple: is the rapid 16S kit's only real advantage the significantly larger 16S data amount generation? Shouldn't I be perfectly able to collect necessary strain-level diversity 16S data on the data analysis level from a total nanopore metagenome, without the PCR bias, given enough sample input? If the above thinking is correct, would you consider triple-digit ng input (below 1ug) sufficient, at least for key players of a mixed microbial community?
Just trying to understand if I really need the 16S barcoding kit since I have the native one (which I will use for total metagenome anyway)
Cheers
A
Hi everyone,
I need your help with optimazing my PCR reaction. My PCR product should be 850bp. Starters Tm is 65, they do not form dimers or secondary structures and they’re specific (Blast doesn’t show any unspecific product that may occur). I've tried gradient PCR with typical mix and with Hot start polymerase and every time I receive strong band that is 150bp. What can I do to get rid of this unspecific product and what can it be?
I successfully amplified fungal ITS from soil samples, however after running the purified PCR products in an agarose gel they are barely visible and don't look like defined bands but rather clouds. The purification was done with the Monarch PCR and DNA Cleanup Kit. Why could this be happening?
Hi, I am using VASA-seq for RNA sequencing. The last two steps of the protocol are cDNA synthesis (via reverse transcription) and PCR. I had been using Superscript III for cDNA synthesis and was getting a lower PCR yield. Then I switched to Maxima H Minus Reverse Transcriptase. The PCR yield increased dramatically, but I am getting this weird around 1200 bp long fragments (see the attached figure). My expected peak is around 300 bp. I have attached a figure of the fragment size distribution of the PCR DNA (analyzed on fragment analyzer).
#fragment_analyzer #PCR #VASA_seq #Maxima H Minus Reverse Transcriptase #SuperscriptIII
Hello. I am having troubles with serum samples. I know that they are positive for Leishmania but when i do the PCR, most of my samples are negative. So, any ideas to have a better outcome? Maybe some extra step.... I use a MagMax kit for extraction, but i can also use Promega and Nzytech. Thank you
Hello! I've encountered some challenges with Traditional PCR.
I've successfully conducted RNA extraction, quantification, and integrity checks, all yielding positive results. (first image its from the integrity of the RNA)
Moving forward, I proceeded with RT-PCR, followed by PCR endpoint analysis using Actin primers. My experimental design involves four treatments, including Ctrl, Resveratrol, LPS, Resveratrol+LPS, with two samples for each treatment.
However, I've encountered an issue where only the controls are being amplified during the PCR endpoint, despite using the same mix for all samples in both the RT-PCR and Traditional PCR for Actin. I'm puzzled and unable to pinpoint the source of this discrepancy. Any insights or suggestions would be greatly appreciated.
The second image its the results of the PCR.
I ran a PCR reaction and it gave good result during the trial run. However, once I ran the same PCR reaction on all of the other samples, there are smears and appearance of non-specific bands. I'm not sure on what went wrong. Hopefully, I could get some insights to fix this issue. Thank you in advance!
Dear virologists; What is the PCR technique used in virology to detect viral nucleic acids? The steps involved.
I'd also like to know, since some viruses have a single strand of DNA and RNA, how does amplification work in this case?
Kind regards
Does anyone have any tips for optimizing PCR reactions with low-quality DNA samples? My interest is in the identification of some species of bacteria using specific primers for each species.
I am working with a DNA sample extracted from different tissues (kidneys, liver, spleen, muscle, cartilage) from carcasses of mammals run over on highways. The tissues were stored in ethanol at room temperature (not my choice) during the collection period, after which they were frozen. DNA extractions were performed with an Invitrogen extraction kit and treated with RNase.
Any help would be appreciated, thank you very much :)
I have been preparing NGS Library, where the samples input volumes, conditions followed and the PCR Cycles are same but still the concentration obtained was uneven and the fragments size where also differ from sample to sample. What could be the possible reason for this uneven results.
I had done PCR using GoTaq q PCR mastermix (Promega) for detection Hepatitis B virus cccDNA. For that purpose, which Ct value I will consider as detected or undetected?
I am trying to insert a His tag in my vector backbone that is of pCDNA.However I am getting wild type colonies of the vector after sequencing. I have used 50 ng of template for mutation PCR and even performed DpN1 digestion for 3 hrs. What might be the reason for getting wild type colonies even after performing DpN1 digestion?
I have designed 2 primers
Now I need to set up the PCR protocol.
First: I need to know how much of each primer, H20 and GoTaq® G2 Hot Start Taq Polymerase to put in the mix. We usually put a total of 14 ul in our PCR = 12 ul mix and 2 ul DNA.
Second: I need to know the temperatures and the durations and number of cycles needed to run the PCR in the thermocycler. Is there a rule to know that?
Please help .. Thank you
Hello everyone
I am working on amplicons for species delimitation on corals.
My supervisor want me to make it through a 4 primers PCR on 4 loci (CR, ITS, ORF and ATPSbeta)
I have been trying for mounth to make this method works but it seems simply impossible
so basicly what i am doing is as follow
my MM is composed of
12.5 µl of green taq
1 µl of inner primer (F and R)
1 µl of barcodes (F and R)
8 µl of water
1.3 µl of DMSO
the cycle is as the screenshot i took (see pictures)
The PCR itself doesn't work, it oly work when i am diluting the barcodes. The more i dilute the more the PCR work (see image barcodes dillution). However if i dilute the barcodes, the PCR product isn't barcoded and it's impossible to retrieve any information from the sequencing.
I have been trying everything to make it work but i feel like there is no solution. Has anyone any advice to make this PCR work with barcoding ?.
I have also tried to separate the inner primer cycle (the 5 first cycle) from the barcodes cycle (the 30 last cycle), it makes the PCR work better but not that much.
i feel like the inner primer also amplificate the DNA in the last 30 cycle and that the barcodes are just amplificating the inner primer and doing dimer. I also tried to dilute the inner primer but then it doesn't work at all
Will my PCR product be viable for Sanger Sequencing? I (a dumb undergrad) left my PCR product in the fridge because I was planning on finishing preparing the samples that week to send out but then my coursework got in the way of that project, and I forgot about the samples in the fridge. Long story short, I left my PCR product in the fridge for about a month, and I still need to send those samples out. My question is, should I send them out as-is, or should I re-PCR them using the PCR product as my sample, or worse, take some of the original (limited) DNA from the extraction for a new PCR? I don't want to waste any of my lab's resources either by sending samples that I should just trash out for sequencing, or by doing an unnecessary PCR/ Gel. Thank you in advance.
I would like to ask about the possibility of using primers <12-15 bases> to amplify very short fragments <35-45 bases>. This is probably a terrible idea and I want to see what people have been doing. Dimer formation, low tm and ta, are a few things that could make this not work.
Let's assume synthesizing the fragment isn't an option as I want to introduce certain changes via the primers for other downstream applications.
Thanks
I want to clone a gene fragment of around 480 bp in the p-RSET-A vector. To do this, I designed two cloning primers that contain the Bamh I and Hind III restriction sites. The primers worked perfectly in the PCR reaction. Subsequently, I performed a double digestion with the enzymes Bamh I and Hind III and carried out the extraction of the band from a low melting point agarose gel. The vector received the same treatment. I performed the ligation reaction at a 1:3 molar ratio and still got the same number of colonies on the V+ control plate as on the V+insert plate. When I performed the restriction and PCR analysis on the colonies on the v+insert plate, none of them were positive. I clarify that in the design of the cloning primers the addition of 6 bp was taken into account to weaken the restriction sites. Can someone help me?
Hello everyone. I am working on antimicrobial properties of yeast isolated from kombucha. So I chose 2 (out of 4) yeast strains with the highest antimicrobial properties, ran a PCR test and then send my samples in order to be sequenced. The BLAST results showed me Candida parapsilosis. I wonder, is this a relevant finding? I searched and read a few articles about this yeast strain's role in fermented foods, it's potential as a probiotic (somehow?) and it's technological properties in fermentation, especially in fermenting glucose and even findings of Candida spp. in kombucha. I am currently writing my thesis, yet as a Master's student, I am somehow worried and not sure to even report it. I am quite sure of my PCR test, as I saw sharp bonds on my electrophoresis gel and used proper primers (ITS and NL-4). Is this data considered relevant or am I being overly-nervous?
Thanks a lot in advance!
They used the same method(P:C:I) for purification
Hey all
I added 10uM of primer instead of 0.5uM in a 10uL PCR reaction. What are the expected results? Will the amplification of the desired product happen by any chance?
What should be the temperature for PCR machine lid during ligation overnight at 16c? Will the usual lid temperature at 105c affect the ligase performance?
Hi. I am tring to express recombinant protein. I obtained the nucleotide sequence of the protein I want to express through cDNA cloning and obtained the ORF sequence of the protein inserted into the plasmid. I designed primers to introduce restriction enzyme sites and confirmed the desired sequence (primer sequence with restriction enzyme sites and the protein's ORF) through PCR and sequencing. The restriction enzymes used are Nde1 and BamH1.
I treated the PCR product and pET28a (a vector for recombinant protein expression) with restriction enzymes. The reaction conditions, including buffer and temperature, were determined according to the manufacturer's protocol, with a reaction time of two hours (manufacturer's recomandation is 1 hour). BamH1 was processed first, followed by PCR purification of the vector and insert. Similarly, Nde1 was processed, followed by agarose gel purification. The purified DNAs were ligated using Takara Mighty Mix and transformed into E.coli BL21 strain. The TF strain was spread on Kanamycin LB plates. The Kanamycin concetration is 50ug/ml. Although there were not many colonies, I obtained a few colonies after about two days. Colony PCR was performed on the obtained colonies, and bands of the desired size (the same size as the PCR for introducing restriction enzyme sites) were confirmed.
Therefore, we attempted to recover the plasmid from BL21 and hoped to confirm it again through sequencing before expressing the protein. However, there is a problem. Surprisingly, plasmid extraction from BL21 does not succeed. Typically, when we extract cloning plasmids in our laboratory, we obtain around 200-600 ng/ml. However, in this case, it is below 50 ng/ml. Despite ignoring the recommended concentration of 100 ng/ml by the sequencing company, we proceeded with sequencing, but no results were obtained. We have tried the described process several times, but we consistently encounter the same issue. Plasmid extraction seems impossible. By the way, the Nde1 site of pET28a exists in the T7 tag region. I am aware that this is necessary for purification. However, since I am going to use a 6xHis tag, I intended to remove it. I am suffering greatly due to these results. Thank you very much for taking the time to read through the lengthy text. I truly appreciate it. Is there something I have overlooked in this process? I seek your professional advice and will strive to follow it as much as possible.
I frequently experience that it does not work while preparing large volumes like 50 μl of PCR mixture, though the same ratios of chemicals operate when I make little amounts (15 μl) of PCR chemicals. What's the probable cause of this issue?
I am working HIV. My RNA concentration is 57-65 ng/ul. AFTER cDNA preparation I did not get any PCR result. Only dimer are on the gel. Highly Visible dimers are on gel.
I'm optimizing an assay which has a target PCR product with size of ~1.1 kb (based on primer in-silico analysis). However, I've been observing distinct PCR bands larger than the expected size. The PCR bands observed has a size of 2.0kb > x > 1.5kb.
We'll sequence the PCR products anytime soon but I want to know why this happens. Thanks in advance!
Hello scientists,
we isolated in our lab a nice promising biocontrol agent (Bacteria), now in field application, we need to re-isolated it and somehow make sur is the right one, we are thinking to go for a PCR detection approach, but to design a specific primers for a specific target ( strain-level) is not easy. I am wondering if you have any idea, how we can do such a thing ? knowing that bacteria was identified ( Pseudomonas synxantha) and we may have the whole sequence in near future.
Thanks in advance .
I faced with a problem, and I think you can help me regarding this issue.
I have sent one of my PCR poducts (ITS1-ITS4) to a company in order to sequence it. Indeed, I sent them various PCR products before and the results are always very nice. However, The result of this latter product is also without any noise but it is only 157 bp long. Do you have any idea why this sequence is very short in size?
It is recommended to store the primers at -20°C. But if someone (forget to keep the primer at -20°C) keep at room temperature for 2 days and then use these.
Q1: Can we use these primer again?
Q2: here is the attached image (File_1.1, compared with the previous results) of using these primers as I could not get the desired results. Could you please tell me is there problem with the Primer or some other issue?
Q3: The faint bands at the bottom are RNA?
Statement 1: we got one sample to have HBeAg ELISA and HBV PCR both Positive, indicating active replication present in the HBV virus.
Statement 2: we got one sample to have HBeAg ELISA negative, but HBV PCR positive, is this possible?
Statement 3: we got one sample to have HBeAg ELISA positive, but HBV PCR negative, is this possible?
Does anybody explain this variation and possibility? Can i get any reference?
Thanks in advance to all.
Hi to all,
Does anybody suggest Pan-HCV and Pan-HBV for conventional and real-time PCR-positive control purposes? Due to viral instability, we are unable to use the known positive samples for cross-checking purposes. we need as follows:
1. Any commercial kit is available?
2. Does anybody suggest to availability of a reference article that we have to follow and buy (synthesis by commercial order)?
Thanks in advance.
The best online resource for conducting in silico PCR simulations of bacterial DNA.
Hi!
We are sequencing exon 5-6 from the BEST1 gene, we have multiple patients afected, with the explaining mutation, but in this cohort we found that in our forward sequences we can identify positively the mutation, but not in the reverse sequence.
Yes, we sequenced them multiple times, with alternative PCR products, primers and looked for pseudogenes regions, but no answer to this phenomena is found.
somebody has some insights?
I have read in several articles that it could be an enhancer of PCR efficiency. Is this the case? How and why?
How do we check the working of designed primers of micro RNA? I have designed primers for my miRNA sequences. I ran normal PCR to check the working of primers, but I couldn't see any bands from my gel, What is the reason? Kindly help me to find it
I AM DOING expression analysis of multiple genes from same cDNA sample and since there are many genes I will perform qPCR over few days9 in a weekend), do i have to prepare actin for each time i do PCR.
Where can I purchase a PCR primer for Elabel/Toddler - an endogenous agonist of the apelin receptor?
Do you have any verified Companies that distribute this primer?
Facing problem with Glucokinase and Glucose 6 Phosphate gene in PCR and qPCR gene expression. I have design the primers as per table attached. I have try to run gradient PCR temp between 54-64°C for 30 cycle for both gene however there is no band was observed and have also try to run qPCR for both gene at 60°C for 40cycle there is no CT value. I have check NTC for both gene is negative. I even tried to add DMSO into the PCR product still there is no band observed.
Please advice how to troubleshoot with this low expressing gene. Is there any other method should be followed?
I am trying to express a fusion gene using pet28a vector initially did a fusion by using SOE PCR method then RE digested the fused gene by using bam nd xho enzymes and ligated with pet28a vector and did a transformation to Top10 cells now where I am not getting the colonies I repeated the same work several times with positive control working fine and all my enzymes are working fine please anyone help me with this problem
Hi everyone.
I have a protocol that generates antibody variable regions from B cell cDNA through nested PCR..
It uses the cDNA as template for a nested PCR reaction series where I amplify heavy and light chain variable regions in separate reactions. I use multiple forward primers (to find as many families as possible) and a single reverse primers for each PCR step.
I have previously successfully completed these reactions multiple times where the final step generates a series of nice, clean band in the 400 bp range when visualized on a gel (Image 1).
Since a couple of months my PCRs are total failures and I can't understand why. The final PCR products are only a smear (image 2 and 3) with weak to non-existing bands. From having nice, clean bands with an around 30% positive hits I get weak, hardly defined bands in a smear and a 2-5% yield.
The protocol is the same, Ive done the following:
- Changed the polymerase to new batch - (no difference)
- New water - (no difference)
- Re-ordered primers - (no difference)
- +/- cDNA amount - (no difference)
- +/- Tm 2°C - (no difference)
I went back to old cDNA that I previously successfully generated nice bands from and now I only get a smear from that material as well....
When doing the light chain reaction with the new cDNA I can still generate nice clean bands (image 4) so the reagents, polymerase, cDNA and thermocycler must work at least semi-correct I assume.
The only thing I have left is the primers but I can't understand why they just would stop working, especially since I ordered them fresh twice now and still can't get the reaction to work. The sequences haven't changed so why would they bind in my first experiments but not now?
Since I don't get enough material to visualize on a gel from the first nested PCR I can't pinpoint if the problem lies in the first PCR or the second.
Anyone here that have experience with troubleshooting PCR, especially nested PCR that have any advice on what my problem could be and/or suggestions what and how to continue my troubleshooting?
Thanks in advance for any suggestions!
I am using PCR Instrument called SLAN from HONGSHI. Any clue?
I am working on overlapping PCR with Left, EGFP and Right flank where same procedure for the primer design of the Left, Right and EGFP was using. But there is Amplification of the Left and EGFP but not the right one. from your experience i need yours advise
Hey! I'm wondering how to calculate the amount of DNA templates to use in my PCR
For example, one of my samples has 359 ng/ul DNA (from NanoDrop)
For the PCR I want to use 40 ng DNA template.
The wells in my PCR will include in total a 10 ul of the following:
- 5 ul Sso
- 0.5 + 0.5 ul fw and rv primers
- 4 ul DNA template (with a conc of 40 ng DNA in it)
Do you happen to know how I calculate a final concentration of 40 ng DNA in this 4 ul template?
Thanks in advance.
Hi to all
Hope you are doing well.
I am amplifying Kan cassette in PkD4 plasmid with 40bp extensions in primers to knockout gene in MG1655 E.COLI by lambda red mutagenesis . the expected product size is 1540bp. As the primers are long so Tm is around 72c for both primers. I run PCR two times by setting annealing temperature 67c and 60 respectively. But both times I get very faint band for product but brighter band for primer dimmer.
On left side I loaded whole 50ul of PCR volume but still very faint product. On right side I loaded 5ul and get very very faint band even you can't see.
Can you please tell me the reason?
I am using Dreamtaq green polymerase,
1% gel, 30 cycles PCR. 5 ul of plasmid with concentration 60ng/ul.
Run the 1kb plus leader on both sides
