Science topic
Reagents - Science topic
Explore the latest questions and answers in Reagents, and find Reagents experts.
Questions related to Reagents
Hey,
I would like to know more about HRM analysing. can anyone assist me regarding the analysing the data which were taken from this experiment?!
I have used MeltDoctor reagent and I calibrated quantstudio 3 with HRM plate in advance. Attached you can see the result from my samples.
Thank you in advance.
Fatemeh
For my protocol, at end-point I have to do tail-vein injections of TRITC-labeled dextran (100 ml of 10 mg/ml) and FITC-labeled lectin (50 mg). However, the protocol I'm following states that they inject one, followed by a 10 min circulation and then the other followed by a 5 min circulation. Tail-vein injections on black mice can be challenging especially two. I know some fluorescence reagents can be mixed but I just want to confirm this can be done.
I am currently trying to do chromosome counts on algal cells. However, I don't have the reagents necessary to extract full protoplasts. But I can make small holes which can allow the DAPI stain to get through. Is there a methodology to do chromosome counts with the cell wall still intact?
I am a first year Ph.D. student in Cell and Molecular Biology department, UT. I am going to start a project on Breast Cancer and for this I need to be skilled on cell culture. I never did cell culture in my undergrad and now after shadowing my PI and seniors in the lab, I started my own session. But unfortunately my cells are getting contaminated. I wash my hands, rub my hand with alcohol, sterilize my hood with alcohol, spray alcohol in every bottle of reagents I use, Using auto pipet ( Big pipet). What else I am missing? I am feeling so pissed off because my seniors are doing the same but they are not facing the contamination. Please help me to overcome this situation.
If an unknown powder or solid sample has given a yellow color result, what INORGNIC or METALLIC COMPOUNDS ARE INDICATED. I am not interested in any controlled organic substances , only inorganic substances. Any shade of yellow qualifies. TY.
I am extracting rna, from sheep goat blood with rna later, I use RNeasy Plus Universal Mini Kit (50) however while I get a good ratio of 280/260, the concentration is very low, does anyone know what blood concentrations and QIAzol Lysis Reagent I need to get a good concentration; Thank you very much
Hello.
I am new to the GSH assay and I am learning about it online. I performed it this week for the first time.
My protocol said to add DTNB and GR to my GSH standards + samples - allow 30 sec the conversion of GSSG to GSH - and THEN - add NADPH and measure absorbance.
Is not NADPH essential for the conversion of GSSG to GSH? Why adding it later?
Also. Can I add just DTNB and measure the absorbance (initial GSH) and then add GR+NADPH and measure absorbance again to measure the total GSH (Initial GSH + reduced GSSG)?
So I can calculate also GSSG (GSHt - GSHi) with this assay (without using vinylipyridine) ?
Hello to everyone!
For the experts of the DNA fiber technique, I am having issues with my fibers. As you can see in the picture, the fibers are all together as a mass and they have not separated nicely. I have had beuatiful fibers in the past but now I am unable to reproduce them (I have not changed the technique or any single reagent whatsoever!). I am aware that the envrironment does play a role for the experiment so I have tried to conduct the experiment in a warm ish place. It looks like either a) there are too many fibers (they should be 8x105 as many protocols state) or b) the lysis buffer has not worked? I am using the technique from this paper. https://www.sciencedirect.com/science/article/abs/pii/S0076687917301143
The cells that I am using is HeLa, a widely used cell line for this tecnhique. I also make sure that the fibers ''travel'' slow enough (5 mins) along the slide because some papers mention that when the fibers go down quickly, they dont get separated therefore they are not analysable (the problem I have!)
Any help would be much appreciated!
I am trying to extract DNA from serum. I found an article that claimed simple extraction can be done in a single tube -
Here they used a solution containing 6M NaI/13mM EDTA/0.5% sodium N-lauroylsarcosine/10 µg glycogen as a carrier/26mM Tris-HCl, pH 8.
But currently, I don't have NaI and glycogen. So, I am thinking of making a solution with KI + EDTA + sodium lauroyl sulfate + Tris-HCl, pH 8. And finally, use Na-acetate and absolute ethanol for the precipitation of DNA.
What consideration should I take into account to use alternative reagents?
And, in their protocol does it mean the final solution containing all reagent should have a pH 8 or it just means the use of Tris-HCL with pH 8?
Dear all,
I am looking for guidance relating to a formula to calculate mass of reagents based on the desired pH and molarity. Is there a formula for this?
I am looking to create, and justify with calculations, a phosphate buffer. I am intending to create phosphate buffers 0.1 M pH 6.0 and 0.2 M pH 6.8.
Thank you in advance for any guidance :)
Kieran
I’m currently using a protein (36 kDa) which needs to be unfolded during a labelling reaction. unfortunately the protein precipitates completely upon denaturation with EDTA which chelates the zinc ions holding its structure together. I’ve tried the reaction at 37, 40, and 55 degrees Celsius all with the same issue.
The exact same protocol (37 degrees, same edta:zinc ratio, time course) works for smaller constructs of the protein. I typically unfold, reduce, and then add the labelling reagent sequentially for 50 minutes each (total 2.5 hours shaking at 37). My protein concentrations have been between 20 and 200 micromolar, and the pH is maintained at 7.8 in 100 mM ammonium bicarbonate buffer (no salt) for optimal labelling.
I need the protein to remain in solution for downstream experiments after the labelling reaction. How can I denature the protein while keeping it soluble?
The protein pI is 7.06, which may be too close to the reaction buffer, especially considering that the other constructs had pi’s at 5.3 and 6.6. I’m considering testing a higher pH, unfolding with EDTA and a detergent, and increasing the salt concentration. Ideally I’d have as low a salt concentration as possible for downstream mass spec, and maintain the pH between 7.5 and 8.5 for optimal labelling with the different reagents. I’d appreciate any feedback or advice!
The Griess assay is not working for the standard curves. I am using 100uM-1.56uM standards. When I add the Griess reagent the high concentrations are yellow. Lower concentrations go very dark pink and crystals form at the bottom. What am I doing wrong?
I have tried isolating ventricular cardiomyocyte by perfusing type II collagenase through adult mice hearts. When looking at the extracted cells under 20X magnification, I don't see the typical rod-shaped cardiomyocytes I was expecting. Instead I seem to have multiple rounder debris. Was I able to extract the myocytes, but they got damaged during the isolation or am I looking at totally different kinds of cells ?
I know immunostaining would be the way to test, however I do not have the reagents on hand.
I am planning to synthesize AgNP using plant extract as a bioreductor.
I have come across several papers recommending a neutral to alkaline pH range (pH 7-8) to achieve silver nanoparticles with characteristics such as small size (<100 nm), uniformity, and stability. In green synthesis approaches, is it acceptable to use chemical reagents to adjust the pH, or are there alternative methods available?"
I would greatly appreciate any insights or advice on these questions. Thank you in advance for your help.
Best regards,
I am planning to synthesize AgNP using plant extract as a bioreductor. In the green synthesis approaches of silver nanoparticles, should I focus solely on preventing the degradation temperature of reducing metabolites such as phenolic compounds?
I would greatly appreciate any insights or advice on these questions. Thank you in advance for your help.
Best regards,
Hello,
I am currently attempting to obtain amplifications of SoxC from a species of onychophoran belonging to the Peripatidae family using primers designed from a sequence of its sister family, Peripatopsidae. The sample I am using is cDNA, and I have tried different concentrations of reagents and cycling times in the thermocycler. However, I have not obtained any amplification yet. I would like to ask how you would start standardizing reagent concentrations and the thermocycler program for a set of primers generated from the sequence of another species for a conserved gene like SoxC (700 bp amplicon).
I have COI as positive, and before using any cDNA for SoxC, COI was amplified.
Due to resource optimization, the primers I use for SoxC had to be initially designed with the sequences of the promoters SP6 and T7.
So these are my primers:
SoxC-F5: ACGCCAAGCTATTTAGGTGACACTATAGGCGGCTACGGATCTTACACA
SoxC-R5: CAGTGAATTGTAATACGACTCACTATAGGGGGGAAATCAAAGTGCGAGCC
none exceed 50% CG.
Additionally, I am conducting tests with cDNA extracted from different tissues and stages to increase the likelihood of finding my sequence, but I still fail to obtain amplification.
I am working on expression and purification of one cytoplasmic protein with His tag, in E coli Bl21(DE3) host cell. Here is SDS picture. Line 2 and 9 are cell lysate, 3,4,7,8 wash steps and 5,6 are elutes using different purification procedure. The expected size is 48 kDa. For protein extraction I used a high pressure homogenizer, also I didn’t use any inhibitors. I was told to try to use Bugbuster protein extraction reagent supplemented with benzonase, do you think it might help?
We used to use the GenomONE HVJ-Envelope reagent from Cosmobio for SCNT / cell fusion experiments. It's been discontinued for years, and they don't know if it's ever coming back. Do you know of a commercial source? Do you have practical experience in making this reagent? Do you have some leftover that you don't need? We can pay well for all of the above.
I am measuring primary aromatic amines by UV-VIS and using the NEDA solution as my coupling reagent. The method says that the reagent needs to be made fresh every day. However, the solution is sold commercially from 0.1-1.0% with a shelf life of 6-12 months. Why does it have to be made fresh? What is its stability? Is it a temperature or UV dependent reaction? Can storing in a brown(amber) bottle and/or refrigerating allow for longer use?
Besides extracting the poorly crystalline Fe- and Al-(hydroxy)oxides, does 0.2 (M) ammonium oxalate-oxalic acid (pH 3.25) buffer extract poorly crystalline Mn-oxides too?
Dear colleagues, help me figure this out.
We are trying to analyze and sort antigen-specific cells using Flex T technology (Biolegend). After UV exchange, the efficiency is 60%. Next, according to the manufacturer’s protocol, we separate and carry out conjugation with streptavidin-PE and steptavidin-APC. And when using these reagents, we obtain a high level of nonspecific staining for each of the fluorochromes.
I can’t figure out why there could be such pronounced non-specificity and how to deal with it. I would be grateful for any suggestions)
Dear All,
We recently purchased Bradford's reagent from SRL. We didn't know the concentration of the solution, if it is 5X or 1X. Nothing is mentioned on the bottle. Also, how to standardize using BSA, how much concentration of Bradford's reagent to use. Please help. Thank you.
I have attached the picture for reference.
I am doing protein estimation from fish tissue by Bradford's method but after adding the reagent cbbg- 50mg, ethanol-50ml, ortho-phosphoric acid- 100ml in 1L soln precipitating clot is shown even in the standard BSA solutiin. Each test tube contain. 0.1 ml sample+0.9 ml phosphate buffer+5ml bf reagent.
I am differentiating monocytes into macrophages from PBMCs, and every time I have encountered these bacillus-shaped elements when I looked them in the microscope at 40x. They are not typical bacteria because I have taken the supernatant from some wells and incubated it with LB medium, but nothing grew. Additionally, the medium did not turn yellow. I have seen it in different cultures in which I used different reagents and donors. Cells do not look atypical.
I left you a video of the culture
Could anybody help me to identify this elements? Are they normal? Some advice?
Thank you very much!
I'm currently trying to make a standard curve for potassium ion detection. For my reagent I'm using 25 mM of sodium cobalthexanitrite with potassium dihydrogen phosphate as a substrate in a 40:60 ratio and measuring at 420nm after incubating the mixture in the dark for 10 minutes. Unfortunately, it's not really working and I'm not getting any precipitation. Is there something more I need to add or a step I've missed? Is my wavelength incorrect?
while performing Bradford assay , I noticed the OD of water plus Bradford reagents was higher then the Bradford alone. So Is there any possibility that if by chance water is contaminated then is there a chance that it will react with Bradford reagent and give different absorbance?
I have three SDS classifications which are Sodium dodecyl sulphate, ACS reagent, ≥99.0%, Sodium Dodecyl Sulphate, >85.0% (T), Sodium dodecyl sulphate, >97.0% (GC)(T). Could somebody tell me which SDS is appropriate for nickel composite coating? The goal is to prevent particle agglomeration
Hello,
I have some problem when using RIPA buffer during reading BCA assay. I'm getting high value of the RIPA's absorbance so I'm getting negative values.
I have Standard curve diluted with PBS and 100ul samples with 200ul of RIPA(X2) and proteinase inhibitor (0.5ul). Then taken the 25ul for the assay plate+200ul WR (reagent A+B).
What is the right blanks for me? (should I substract PBS value from the standard curve absorbance and substract RIPA+PBS+PI from the unknown samples absorbance value?)
Maybe:
Blank 1 - PBS (for standard curve)
Blank 2 - 100ul PBS (instead the sample) + 200ul RIPA(X2) + 0.5PI (for unknown samples)
What can be the problem? and do you have some suggestions how to calculate it?
Also what is the right graph type? 4PL/point to point/linear regression?
Thank you!
I am working on the effect of heavy metals on plants. However, to check the activity of antioxidant enzymes I need to prepare reagents in bulk. Buying an assay kit is not affordable. Can someone kindly suggest a protocol for reaction mixture (reagents) for the above-mentioned assays (Please specify the volume of each reagent and its concentration)
Crosslinking on surfaces makes the enzyme reusable multiple times, I wish to know whether this is possible for a chemical reagent. Once fixed or coated on a surface, can the reagent be used multiple times for a microassay? And if this can be done, please direct me to a source. A research paper/any kind of literature would be helpful.
I use a DNA/RNA synthesizer from LGC (Biosearch), a MerMade6, to make oligos. The machine has operated for around 16 months and produced about 1500 oligos during this period. As you can see, it is not a heavily used machine.
All preventive maintenances were ok, and the machine was operating just fine and yielding very good quality oligos......
But then it started to present a misalignment between the cart/columns block and the capilaries, pouring reagents out of the columns.
If you look closely you can see that, when the cart with the columns moves and gets to the position assigned, it doesn't stop completely, but slides juuuust a little bit instead. Such a mess!
Calibration doesn't solve the problem: after a calibration, reagents will be delivered correctly into the columns in the first cycle, but as with every move the cart slides a little bit, the misalignment starts to sum up with every move and, at the 3rd cycle, reagents are being spilled outside the columns already.
We are in Brazil. Remotely, LGC team couldn't help. They couldn't even find the problem. The visit of LGC engineering team will coast a lot, and while we are working in resources an bureaucracies to get them here, tips from other users would be welcome and much appreciated.
This machine works with step motor / step motion, which is similar to printers and a lot of other machines. Have you ever seen this kind of issue?
Alternatively, do you know other MerMade users you can put me in touch with?
Thanks in advance
I want to prepare a cell-free system by following the protocol shown at the bottom, in which the tRNA from E. coli (Catalog number: MRE600 provided by Roche Applied Science) is an essential reagent. However, Roche seems to no longer provide this reagent. Therefore, I just wonder if there are any substitutions to this compounds so that I could prepare the cell-free system. Thanks!
We have expressed and purified the recombinant viral protein found in the insoluble fraction. Please suggest some methods or reagents to solubilize the protein.
We have expressed and purified the recombinant viral protein found in the insoluble fraction. Please suggest some methods or reagents to solubilize the protein.
Is there any recommended protocol (reagents' concentrations) for RT-qPCR in human postmortem brain tissue for the identification of NR2A (NMDAR) subunit? I cannot find neither a protocol let alone ranging concentrations.
Has anyone used an alternative tranfer buffer, for a semi-dry tranfer? Currently we are using a Thermo-Fisher branded one, but its running out and the recipe/reagents are propietary. Does anyone have an alternative protocol for this?
I have performed 3 RNA isolations on Jurkat cells using the phenol-chloroform principle, using Omega Bio-Tek RNA Solv® & following the protocol. I took care in not disturbing the separated phases when removing two thirds of the aqeous phases but the data I get when I measure the 260/280 & 260'/230nm absorbance ratios lead me to suspect contamination of the samples with phenol or other reagents.
Most of the samples have a 260/280 ratio below 1,6 and only one sample has a 260/230 ratio that comes close to 2 (1,84 to be exact). Subsequent cDNA synthesis & RT-qPCR have not resulted in genes of interest to show any fluoresence at all, only the housekeeping genes in 2 of 7 samples showed up. Problems with primers & RT-qPCR were ruled out as the same setup yielded viable results previously.
Thanks in advance!
Hi all,
I did a mock transfection using pGL3 vectors with different promoter inserts (plasmids range from 10 to 14kb). However, I have gotten unexpectedly low luminescence ratios (firefly luc / renilla luc) and I was wondering if it would be logically sound to transfect mols of DNA instead of a certain weight for all of them (eg. 200ng per well). Thoughts?
Thanks!
I intend to do a chemical reaction and have seen that ethanedithiol would be a good reagent, however, I do not know how it smells.
I would like to know if it is a common reagent kit for the target amplification of both DNA and RNA, or does it show amplification only for the RNA targets. Will the presence of DNA in the sample affect the reaction and its results?
basically, we are conducting a electrocoagulation experiment and will be using this process to reduce nitrate to a certain level. However, we are struggling on what reagents to use since the nitrate checker from HANNA instruments is not an option since it can only detect from 0 to 75ppm. In the nitrate checker from HANNA instruments, they used malonic acid for their reagent but I'm not sure if its still useable at higher concentrations of 75ppm or do we use Griess reagent?
I have access to simple reagents,LB, spectrophotometer etc. Can I determine the phosphate solubilization rate using these. Also please explain the procedure so that I can understand easily.
I want to measure the concentration of cobalt(II) and cadmium(II) with UV-visible.
I want to know what are the alternatives for Ficoll- paque plus. Can we use sucrose/percoll/Na metrizoate/Caesium chloride for Monocyte isolation
Why sodium hydroxide can cause increasing the fluorescence intensity for a fluorogenic reagent however acetone completely diminish fluorescence peak of the same reagent?
We have to add specific molar concentration to the media (10^-6M). it is labelled as 1000X how can we convert it.
Using Dimethyl formamide as dissolv reagent. The Eclipta prostrata powdered extract has been purchase.
I've been trying to replicate aqueous extractions using MTBSTFA and running on the GC-MS (I've done this before and it had worked). My solvent blanks are clear however it seems whenever I add MTBSTFA there is a lot of contamination peaks (both in a standard test and in PB). Could this possibly be a column issue? It's fairly old and has been used with other derivatization agents. I've tried 3 different MTBSTFA reagents and acetonitriles as I initially thought that might be contributing but all the results have been the same.
I try to find out microstructure of 17-4 PH stainless steel. I have used two etchants, they are
1. Kalings reagent
2. Fry's reagent
Sample was immersed for 45 sec in each case.
I have added some pictures for reference. Picture 2 and 3 are images from Fry's reagent and pictures 4, 5, 14 and 15 are from Kalings reagent. These are the microstrctural images of solution treated specimen not aged. As 17-4 PH is a martensitic precipitation hardening stainless steel. kindly tell me whether it is correct or not and also recommend me any other etchant for microstructural study.
+1
I use restriction enzyme cloning method, and I have been using new reagents e.g., competent cells, and ligase reagent because initially I thought the problem is that these reagents were outdated. Now with these reagents I attempted to clone my shRNA into the vector with 1:3 DNA:insert ratio, but I didn't even see a single colony.
Dear colleagues, I would like to load an aminoacid on Wang-Harz resin. Most protocols are using HOBt in order to activate the aminoacid. Would be possible to use PyBoP reagent for this purpose? Did someone try such coupling strategy? If yes, could you share a well-established protocol.
Thank you in advance,
Robert Gradinaru
Chemistry, UAIC, Romania
Hello, I am working with the aforementioned reagent, but my problem arises that the reagent does not indicate the quantity of particles that come per vial, that is, the number of particles, it only gives me the concentration, which is 1 mg/ml in 2 ml. .
My question is if anyone has worked with this reagent and can tell me the number of particles.
Thank you so much
im really sorry for my grammar, english is not my first language.
What are the best chemical reagents (i.e. spray reagents) that can be used on TLC plates to detect the phytochemical constituents of each of the extracts mentioned in the previous question?
Hi Everyone,
I have difficulties with my current work analyzing S-Methylmethionine(SMM).
According to several reports, the analysis of SMM can be done by HPLC with a UV detector (338nm) and OPA reagent. Meanwhile, there is another report showing SMM still can be analyzed without OPA. Later on, I tried to follow the report but I failed to obtain the SMM peak chromatogram.
FYI, the system that I used in my lab:
- HPLC (THermo vanquish)
- UV-DAD detector
- Zorbax AAA column
- 40mM NaH2PO4 (mobile phase A)
- MeOH:ACN:Water (45%:45%:10% mobile phase B)
Please let me know If you guys have any information or experience about analyzing SMM without OPA.
Thank you
Hello, I hope you are well, I have been searching and I cannot find the components to make an RNase decontamination reagent in the laboratory, without having to buy the RNase away.
Thanks
Hello!
I am relatively new to what I'm currently working with and as the title suggests, I am currently having some issues with my experiment (viral titration).
So, what I have been doing is the following:
1) Seeding cells on a black grenedier 96-well-plate, by extracting cells from culture flasks with Trypsin, counting and diluting them to a sufficient concentration for seeding.
2) The day after, a virus dilution series was performed in infection medium, and the cells in the grenedier well plate were infected in different concentrations, including negative controls.
3) After incubation, all the cells were fixed using the reagents: PFA, Methanol, PBS.
4) After fixing, the plates were stained using a primary, and a secondary antibody attached to a fleurophore. The primary binds to a viral protein of interest. The antibodies were diluted in PBS, and the second one also with Hoechst. The staining was performed with standard conditions, including incubation and washing 3 times with PBS after each antibody. The plate was stored in a fridge over night before analyzing it.
5) The infection was visualized using a Cytation 5 plate reader.
Now, the issue Im facing is that I have kept seeing some infection in my negative controls, (which should have un-infected cells only), according to the images which showed the flourescent dye in these wells. I am trying to figure out what I am doing wrong.
I have been pipetting from lowest to highest concentration, when adding media or PBS, and used separate liquid plastic containers for the control-wells and the infected ones, to avoid contamination. I am going to redo it once again using new infection media, in case the old flask had contamination.
But apart from this, what other factors could possibly help explain why I keep seeing flourescence from the secondary antibody in my negative controls? ANY type of mistake I could possibly have been making I would love to have pointed out. Or other factors which could cause contamination in the lab.
Could PBS/the other reagents possibly be contaminated as well?
Could it be I am not washing away secondary antibodies sufficiently?
Any tips would be much appreciated!!
Hello!
I am relatively new to what I'm currently working with and as the title suggests, I am currently having some issues with my experiment (viral titration).
So, what I have been doing is the following:
1) Seeding cells on a black grenedier 96-well-plate, by extracting cells from culture flasks with Trypsin, counting and diluting them to a sufficient concentration for seeding.
2) The day after, a virus dilution series was performed in infection medium, and the cells in the grenedier well plate were infected in different concentrations, including negative controls.
3) After incubation, all the cells were fixed using the reagents: PFA, Methanol, PBS.
4) After fixing, the plates were stained using a primary, and a secondary antibody attached to a fleurophore. The primary binds to a viral protein of interest. The antibodies were diluted in PBS, and the second one also with Hoechst. The staining was performed with standard conditions, including incubation and washing 3 times with PBS after each antibody. The plate was stored in a fridge over night before analyzing it.
5) The infection was visualized using a Cytation 5 plate reader.
Now, the issue Im facing is that I have kept seeing some infection in my negative controls, (which should have un-infected cells only), according to the images which showed the flourescent dye in these wells. I am trying to figure out what I am doing wrong.
I have been pipetting from lowest to highest concentration, when adding media or PBS, and used separate liquid plastic containers for the control-wells and the infected ones, to avoid contamination. I am going to redo it once again using new infection media, in case the old flask had contamination.
But apart from this, what other factors could possibly help explain why I keep seeing flourescence from the secondary antibody in my negative controls? ANY type of mistake I could possibly have been making I would love to have pointed out. Or other factors which could cause contamination in the lab.
Could PBS/the other reagents possibly be contaminated as well?
Could it be I am not washing away secondary antibodies sufficiently?
Any tips would be much appreciated!!
I have tried PEI and lipofectamine 2000 to deliver a GFP plasmid into HEp-2 cells, both showed low transfection efficiency. Does anyone have good experiences in HEp-2 transfection?
I would like to simulate a process, I know T,p, and the selectivity. Can I calculate the reagent conversion in Aspen Plus?
In that case, what kind of reactor should I use?
Thank you in advance.
I'm encountering a PCR issue in our experiments. We employ a master mix as control and utilize 3 or 4 primers in a single reaction. Since our samples are typically heterozygous (containing both wild-type and mutant alleles), it's expected to observe two bands as results. In one particular PCR, I'm consistently observing a faint wild-type band in the master mix. I've repeated the experiment using all-new reagents, but the outcome remains consistent. This light band consistently aligns with the length of the wild-type. Is it common to observe such bands depending on the choice of primers? What are the places I can improve.
How l can measure the presence of micronucleated red blood cells among normochromatic red blood cells by using the flow cytometry technique.
I need the details protocol with what the reagents should be used
I want to estimate phenol in methanol crude extract and I dissolve 1 mg/ml of crude extract as a sample then i took 500 μL of it then add 100 μL of FC (50%) reagent then add 500 μ of 20% Na2CO3 then incubate it for one h then i took 200 μL of it to 96 plat then i read absorbance at 750 nm ( Same i did for gilic acid i prepared in deffrent conc ( 5, 10, 15, 20, 25 ,30) μg/ml and i add DW to make volume 500μL then i add 100μL FC then 500μL of NaCO3 then incubation for 1 h then i took 200μ of every conc to 96 plate and i read absorbance How can we calculate the total phenols in the methanol extract ?
What concentrations of reagents are recommended to start standardizing an RT-PCR primer set?
Hello,
I've been having issues with my cDNA PCR which used to work previously. I'm working with cDNA from velvet worms, amplifying Cox1. Earlier, I had successfully amplified Cox1 with specific parameters that I managed to standardize. However, suddenly it stopped working when I changed the cDNA samples, and even when using the previous sample, I couldn't get amplification. I tried using new reagents at the same concentrations and only got smears. I attempted a new cDNA synthesis, considering potential degradation, but again, only smears. I experimented with different concentrations of MgSO4 (1.2 mM, 1.5 mM, 1.8 mM, 2.0 mM, and 2.2 mM) and still only got smears. I tested various cDNA concentrations and got smears as well.
I'm unsure what else to try, and I would appreciate your guidance and recommendations on this issue.
I would like to measure the protein concentration using the Bradford assay. To do this I have to resuspend the isolated protein pellet in the sample buffer. However, at this stage, I do not have ampholyte reagent to make the rehydration buffer (I do have Urea, DTT, CHAPS and Bromophenol Blue). After this, I want to rehydrate the IEF gel strips as the first dimension gel and then run 2nd dimension gel. I am wondering if missing ampholyte in the rehydration buffer will considerably affect the result. How important is the role of ampholyte?
Any suggestions and comments would be greatly appreciated.
Use of anti-FcR-antibody is popular among reserchers to study PBMCs. But is it realy neccessary to use them? Since people also use blocking reagents which seems to be working fine with most of the cases.
Please share your experiences in this regard and explain in detail.
I'm using a phosphate assay kit from a company, which doesn't divulge the specifics of what's in their reagents. To prepare it, we mix a yellow-colored solution with a very small volume of clear solution. I'm trying to understand which solution has the molybdate or the malachite green, or whether they're already mixed together beforehand. Can anyone help me based on this information?
What's your experience with this conjugation method? I want to try a proximity ligation assay and I know there's kits out there that seem to be quite pricey and there are methods to simply bind Abs-oligo. I'm wondering how ppl get around the clean up step prior to adding to the target if they don't use a kit? Does anyone know what is in the Clean up reagent in the kits? Do people use columns.
Any help would be great.
Hi,
I have a problem regarding Bradford protein assay. When I dissolve Coomassie Brilliant blue G-250 (C.I. 42655) in 96% ethanol, the solution is blue. Upon adding phosphoric acid, it turns into red-brown. But, when I add water to make up to the final volume, the final solution is blue. Shouldn't that be a red-brown solution?
Many thanks for your comments.
Siavoush
My electroactive substance is only soluble in chloroform, I have tried mixing it with Triton x 100 but it still doesn't dissolve in PBS. Is there any reagent I can use to facilitate the dissolution of chloroform in PBS?
I'm trying to assay different lipases and their kinetic parameters using Ellman's reagent and DMPTB as a substrate.
I've tried to measure the rate of reaction using a microwell plate in a spectrophotometer.
My protocol consists of making a premix with 0.5M Tris, 0.1M EDTA, 5% Triton, MQ water and 40mM DTNB. I'll add specific volumes of the DMPTB, mix it with the lipase and then assay it using the microwell plate. I have found that there is not colour change in the assay unless the DMPTB concentration above 5mM, so I have tried assaying different concentrations of DMPTB between 5-20mM.
However, at increasing concentrations of DMPTB (above 10mM) the rate of reaction does not increase with DMPTB (i.e. not following M-M laws)
I have also noticed precipitation in DMPTB stock solution (dissolved in Triton and 50mM Tris). But I vortex the solution prior to pipetting to offset this effect. Could this be contributing to the problem I'm seeing?
Any help would be great !
I would like to isolate RNA from plants, is an low cost RNA isolation protocol available? Preferable using Chloroform as main reagent.
Thank you in advance,
Kiriakos Athanasiadis
I need to make a standart curve for quantitative the ammonia produced by bacteria Bacillus. I want to make standart curve ammonium chloride with the various standart 0-20mg/L. And then I was take 25uL of each standart added to 850uL H2O and 125uL of Nessler reagent was added. Please help me to solve how to make various standart.
Thanks
I am using 100 and 120 nm latex particles and monoclonal and poly-clonal anti-crp antibody. i tried with Tris, Glycien, PBS, and MES buffer with different molarity (10 to 100 mmol) but not getting linearity more then 100 mg/L.
I would like to add BG-azide to cells for SNAP tag pulldown however I don't know whether it is going to be cell permeable. My instinct is to day yes it will be but neither me nor the supplier know whether that is true. I thought I would ask if anyone has tried something similar, even though that is unlikely... I have attached the structures in case that is informative
These are the products https://www.iris-biotech.de/global/rl-3950 and https://www.iris-biotech.de/global/rl-3960
Looking to perform TEM on tissues that have already been processed via RNAScope. Are there concerns with viral and/or cellular degradation from RNAScope reagents that may prevent TEM from detecting the molecularly-confirmed virus?
All parameter is ok but hemoglobin is 4% higher than control. the formula is SDS + Triton x100+ phosphate buffer.
Hi, I'm trying to block FcR on human macrophages in some in vitro cocultures with human T cells. Is there any FcR blocking reagents used in vitro culture?
Thanks,
Kun
I am a novice in chemical experiments,and my teacher wants me to use steglich esterification reaction(add DCC and DMAP) to make PEG and RAFT reagents(DDMAT) react into a macromolecular reagent(PEG DMATmacroCTA), my method is as follows:
Under stirring conditions of 0 ℃, the dodecyl S'-( α,α'- Dimethyl- α″- Acetic acid) tri Thiocarbonic acid (DDMAT) (0.5485mmol, 200mg), PEG-400 (0.2493mmol, 99.72mg) and 4-Dimethylaminopyridine (DMAP) (0.0997mmol, 12.18mg) were mixed in 15mL chloroform (super dehydrated grade), and dicyclohexyl Diimide (DCC) (0.5485mmol, 113.17mg) dissolved in 5mL chloroform was dropped into it, further stirred at 0 ℃ for 1h, and then stirred at room temperature for 72h, Concentrate the filtrate and separate it by Column chromatography.And this method is derived from my first linked literature, which was used by the author to synthesize T2 using ethylene glycol and RAFT reagent.
However, I repeated the experiment twice but failed. The points seen through thin layer chromatography cannot be separated through column chromatography, I am also unable to determine whether the newly generated point is my product point, and the substance seems to decompose easily. It always disappear during the post-processing process.
I want to use the classic acyl chloride method for synthesis(The references are in the second and third links), but my teacher doesn't seem to want me to switch methods.
So I really want to know which step went wrong and why I couldn't get the product. If you need more specific experimental details, please contact me. I write a lot to describe my difficulties, and thank you for spending your time to read it. If you can provide suggestions, I would be very grateful.
I would like to know your opinion on kits for separation of nuclear and cytoplasmic fraction. I have used NE-PER™ Nuclear and Cytoplasmic Extraction Reagents, but I was not satisfy with the results even though I did some optimizations. Now I'm planning to order Cell Fractionation Kit #9038 and I need some helpful information if I made a good chose. I'm open for any suggestions. Thank you in advance!
Hi there!
I got amplification of my genes in the negative control in Real-time PCR experiment although the Ct values were above 30. I setup my reaction again after making new dilutions of PCR reagents, cleaning the workbenches, using unopened autoclaved tips, and cleaning my pipettes with 70% ethanol. I tried to remove every possible source of contamination but still I am getting the same Ct values in my negative control. It is a TaqMan probe-based multiplex PCR reaction where I am amplifying three genes in the same reaction and I am getting amplification of two of these genes in my negative control. Can anyone guide me how to get rid of this amplification?
in the experiment to quantify the ability to produce siderophore in rice roots by CAS reagent. We have performed 3 times at different levels, but the OD measurement result is still negative. Tell me the reason
First time: 600ul bacterial epidemicin, 600ul CAS reagent. Measured at 630nm
Second time: 600ul bacterial epidemicin, 600ul CAS reagent. Measured at 530nm
3rd time: 900ul of bacterial epidemicin, 100ul of CAS reagent. Measured at 630nmm
Looking for Protocol of GRIESS reagent test on brain.
many thanks
Kindly tell the electrolytic polishing reagent as well as chemical and electrolytic etchant for 304H austenitic steel.
Hello everyone. I want to perform TPC assay for phenolic content estimation of my honey samples.
However, the only FC reagent available in my lab is from Sigma Aldrich that got 'suitable for determination of total protein content by lowry method' on the bottle label.
Is it still suitable to be used for my TPC assay or should I purchase another one?
Thanks a lot for your advice!
Do you need to wash with ethanol or another non-polar reagent in the washing step to obtain a HTC hydrocarbon with higher purity? in addition to washing with distilled water.
hello, I have a major question that i would really appreciate if anyone could make me clear.
In a project I am going to transfect BMSCs with a plasmid by lipofectamine 2000 reagent.
then the transfected cells will be transplanted to the rat brain.
SINCE the rats are going to be tested for 10 days after cells transplantation, THE QUESTION IS THAT can plasmids remain in cells during this time and efficiently express the desired gene or not?
When i started my real time pcr experiment i was using applied biosystems power up sybr green qpcr master mix. i was getting my results with a proper melt curve of my target gene at 83.5 degree Celsius and housekeeping gene at 85 degree Celsius. but this reagent was limiting, so i had to shift to applied biosystems power sybr green, and after that my target gene did no show a melt curve. even for housekeeping gene the melt curve decreased to 83 degrees. in this entire experiment the only change was for sybr green reagent. i ran a control, where i freshly prepared rna, and set up real time experiment simultaneously with 2 sets of sybr green, i got the melt curve as well as band in agarose gel for power up sybr green, but not with the power sybr green.
I'm making 4 formyl carbaldehyde by cycling the hydrazone derivatives using vilsmeir hack reagent . But after 15-20 days my product is showing two spots in tlc. One non polar spot is generating extra.
I'm using 20% Ethyl acetate: Pet. Ether as eluent.
Can anyone explain why or how can I avoid it.
As we are finding difficult to secure the Trypan Blue supplies in Colombia, i would like to know if there is any alternative reagent to Stain the PBMC cells.
Hello,
I need to ask about why DS value is decreasing when increasing molar ratio of reagent?
First I would like to tell that I performed 5 synthesis of cellulose with vinyl laurate. The result of DS is decreasing when I increased molar ratio of vinyl laurate. Kindly tell me why I am getting this decreasing trend and also my DS values are less than 1, least is 0.16 and highest is 0.40.
Kindly help me out.
Regards
My graduate work was in C. elegans, and this is my very first time performing live cell imaging in human cell lines. (fibroblasts)
I would like to use live cell imaging to track two proteins of interest, but I am not sure where to start.
Does anyone have recommended reagents, plasmids, or protocols?
Hi, I normally use Lipofectamine 2000 reagents for siRNA transfection, we adquiere a new lot, and in the second use, after taking it from the refrigerator, I put it on ice, and at the time of use I noticed that the tube appeared cloudy, I thought it was frozen, after a minute and shaving it looked normal but cloudy, I have made my transfections with out problem, but the transfection is in OptiMEM with out serum or antibiotics for 18 hours, after that, I harvest the cells for TRIzol RNA extractions, the cells and transfection process look perfectly normal after those hours in OptiMEM. We suspected the reagent to be contaminated, but we haven't made sequential experiments involving reseeding the cells in other media.
I want to know the composition of anti fluorescence quenching reagent,how can i make it .
I am trying to use BriteVu casting reagent to perfuse the coronary vasculature and image using microCT. I have tried 1) perfusion via catheterization of the descending aorta with ligation of aortic branches and 2) injection directly into the LV without aortic ligation. Both methods of yielded incomplete and inconsistent filling of the vasculature. I am seeking protocols, tips, etc. to improve our perfusion protocol.
Characterizing a GPCR-ligand interaction is critical to understanding the biology of the receptor. As GDP/GTP exchange is one of the earliest events that follows ligand binding, monitoring GTP binding can measure GPCR activation or inhibition. Assaying more downstream events in GPCR signaling is often not as quantitative or stoichiometric, may not distinguish full agonists from partial ones, and can require expensive reagents. Moreover, increased GTP binding to Gα proteins is an almost-universal event following GPCR activation, meaning that measuring GTP binding is a broadly applicable assay for monitoring the activity of most GPCRs. Measuring GTP binding is a simple and rapid approach to monitor GPCR signaling in cells overexpressing the receptor of interest or in native tissue. The present protocol details a functional GTP-binding assay using an archetypal GPCR, the µ-opioid receptor (MOR1), to quantitatively determine the activity of an agonist and antagonist on GPCR signaling.
But we are facing some logistical issues acquiring the ([35S]GTPγS), and due to shortage of time we need to measure the GPCR signaling without the radio-labeled ([35S]GTPγS).
Could you please help me out and suggest some alternate approach?
Hi,
I'm looking to learn how to use RNAscope. I could have access to some of the reagents but they are expired. Since the reagents and probes are quite expensive, I was wondering if I could use them despite the fact that they are expired.
Thank you for your comments.
Mathieu
I am using the Cell Biolabs Inc. AAV Purification Standard Kit to purify Adeno-Associated Virus particles, but unfortunately, I have lost the Reagent B. I have checked the product manual and website but cannot find any information about the specific function of this reagent. Does anyone who has used this kit before know what Reagent B is used for and what its composition is? Any help or suggestions would be greatly appreciated.