Science topic
Enzymes - Science topic
Biological molecules that possess catalytic activity. They may occur naturally or be synthetically created. Enzymes are usually proteins, however CATALYTIC RNA and CATALYTIC DNA molecules have also been identified.
Questions related to Enzymes
Hello all,
I have a mini-prepped DNA that I am trying to digest with EagI. After doing the digestion it looks like the reaction with the restriction enzyme maybe linearizing my plasmid as it migrates at its expected weight when next to the DNA ladder. However the undigested sample runs very high, far above the 10kb band of the ladder. I am guessing this is the uncut is showing a nicked plasmid, which is why it's running so high? What do you think?
Thank you
MB
For carbon conversion , the use of biocatalysts must be optimized, so what are the strategies used for this purpose?
i want to test the alpha amylase inhibitory activity of various pharmacuticals. is it possible to use alpha amylse from Aspergillus oryzae alpha (800EAU/Gram) to analyse in vitro alpha-amylase inhibitory activity using DNS Method. and what is the amount to enzyme (in ml) should i use?
The biocatalysts can be more available than traditional catalysts? The quation is related to the sustainablity by conversion of carbon using biocatalysts.
Dear Colleagues,
I working on evaluation of choline esterase inhibitors activity,the problem that I don't have the enzyme.
so i am trying to extract it from red blood cells of mice , rats ,rabbits or human .
can any one help me.
I'll appreciate every answer even if it is not suitable for me.
thank you in advance.
I would like to understand the calculation of % enzyme inhibition
Say I have synthesized a new compound that gives great results against e. coli, how to know the best enzyme to target in e. coli? or how to predict the most possible target?
I'm working with recombinant protein, it's a protease enzyme that we use E. coli to synthesize, and usually, it's stable for up to six months in the -80 freezer. Recently, the protein activity has been acting weird or showing a sudden drop after just two months, knowing that this enzyme is not expected to digest itself. Does anyone have an explanation, or even know how to solve this problem?
Thanks
I did as follow. I mix 1ml of starch with 1ml of crude enzyme. incubated for 15 minutes. After that I added 1ml of DNSA and bioled for 10 moinutes. after boiling i added 5ml of distiled water. thes measured absorbance at 540nm. my maltose standard curve equation is y=0.0009x + 0.01. how can I calculate Enzyme activity?
I am trying to express a FAD containing enzyme of mycobacteria in E.coli. I am able to purify the protein which is slightly yellow in color but it seems that my FAD is all unbound to the protein. How can I express the protein which has tightly bound FAD?
Dear Research Community,
I am encountering a significant hurdle in my research involving enzyme inhibition testing. The inhibitor I am investigating exhibits solubility exclusively in DMSO, rendering it insoluble in aqueous environments such as the 100mM phosphate buffer I am utilizing for enzyme kinetics studies. Upon attempting to incorporate the DMSO-dissolved inhibitor into the reaction mix, it precipitates out, leading to haze formation in the solution and hindering accurate data collection.
I am seeking insights and suggestions on how to effectively address this challenge. Specifically, I am interested in methodologies , or alternative solvents that could facilitate the integration of the inhibitor into the reaction mix without inducing precipitation. Additionally, any advice on modifying experimental conditions or buffer compositions to mitigate this issue would be greatly appreciated.
Thank you in advance for your expertise and assistance.
I need to develop an enzyme assay to evaluate the degradation of gluten using proteases. Previously, I conducted tests with finished products, which was straightforward. However, I now have to work with actual enzymes, which are in limited quantity. Consequently, I'm facing challenges in devising an assay method. The total enzyme quantity available is 100ml, and I need to conduct multiple tests to assess the enzyme's activity in degrading gluten. Could you please provide assistance in formulating an appropriate assay method for this task?
I'm using the Chen&Wente protocol: https://www.addgene.org/static/cms/filer_public/02/12/0212c99c-6937-4884-8fb0-a097b965f1c3/sgrna-plasmid-construction-protocol.pdf
This is supposed to be extremely efficient, but somehow, I've never gotten it to work. I ordered completely new enzymes because I thought my enzymes may be thawing (I re-ordered BsmBI, BlgIII, and Sal1HF), and my negative control had a greatly decreased number of colonies compared to my guide+plasmid plates for the first time; hence, I thought my enzymes were the problem. However, upon sequencing, I still got empty vector. Should the next step be to order new ligase? I'm not sure what's going wrong!
hi everyone,
i am trying to figure out why the gene inserted is not amplifying after cloning. I have inserted a mycobacterium-specific gene into pET 32a plasmid and transformed the ligation product with BL21 cells. after transformation, I have isolated the plasmid from the obtained clones and done restriction digestion with the desired restriction enzyme. i have got a positive result for this experiment by running the restriction digestion product in 1% agarose gel. hence i kind of confirmed that the cloning has worked. ionrder to re confirm it, i have done a colony PCR with the obtained transformant colony.but i have got no amplicon for the gene. i have also tried to amplify the gene from the isolated plasmid using the gene-specific primers,but that also gave a negative result. i have repeated these experiments for multiple time but each time am getting the same pattern of result. that is a positive result for restriction digestion of the isolated plasmid and negative result for the colony PCR as well as the plasmid PCR. what can be the possible reason behind this. also i tried to express the protein using iptg induction, that also resulted in negative result.
An enzyme protein overexpressed in bacteria needs to be purified to show its activity. Why doesn't the cell lysate show activity when added to the substrate?
Hello everyone,
I am interested to know how I have to calculate the concentration of a specific analyte during the digestion steps (salivary, gastric, intestinal...).
During the method, the sample is dissolved by half between steps, for example: salivary (50%); in gastric step, the salivary step is dissolved by half with the gastric enzyme mix, so the sample is dissolved at 25%... etc etc.
When I obtain my quantification data after LC/MS analysis, how should I express my results? Do I have to take into account the dilution factor for each step? (Saliva x2, Gastric x4 ....)
Kind regards,
José Ángel
Hello,
I am using Trypsin to determine its Km and Vmax values against casein from bovine milk. I know higher enzyme concentrations increase the Vmax value, but does more trypsin also affect the Km value?
Thank you in advance
Jordan
I need help analyzing enzyme kinetic data.
I have data from the Octet K2 system. In my experiment, I load the sensor with our protein of interest (6XHis tag on my recombinant protein to Ni-NTA sensors) and then expose this sensor to increasing concentrations of the candidate binding protein (five concentrations per experiment and each experiment is replicated four times). Each association step is followed by a dissociation step in buffer. A control sensor is used in each experiment where a sensor is loaded with the protein of interest but only exposed to buffer. (See picture, Part 1)
I have separate data where I loaded smaller recombinant domains of the protein of interest to the sensor and exposed it to the candidate binding protein. I would like to combine this data (the binding of the full-length protein and the binding of the domains) on the same graph.
My problem: In trying to analyze the data with the software provided with the Octet system (HT 11.1), the data misaligns. (See picture, Part 2)
My goal is to determine kinetic constants (KD) of the full-length protein and its separate domains to the protein of interest.
Suggestions for correctly aligning the data in the Octet software HT11.1? (I think the misalignment is because the program is trying to align the y axis to baseline 1 instead of baseline 2, which is the baseline right before the association step. If so, can you change this label after the fact?)
If the glitch with the Octet software cannot be fixed, then is there a manual/tutorial for the enzyme kinetic module for Sigma Plot?
I found I can extract the raw data from the Octet system. I can remove the background from the control sensor and manually assign concentrations. I uploaded this into Sigma plot 15, which has an enzyme kinetic module. I found the embedded help guide, but I have specific questions. For example:
*My candidate binding protein does not change, but how do you take into account the change in the kilodaltons of the proteins that are loaded to the sensor, full length vs. the smaller domain proteins? This is automatically taken care of in the Octet software.
*How do I differentiate between the association and dissociation phases?
I am new to Octet biolayer analysis and the Enzyme Kinetic Module analysis in Sigma Plot.
Any help will be greatly appreciated! I am happy to provide any more information.
I am working on an enzyme and checking its stability in different solvents. One of the solvents is DMSO. I am interested in checking how much active or correctly folded protein is still in the reaction mixture after exposure to DMSO or any other solvents after a certain amount of time.
I've selected protease as the optimal enzyme for eliminating gluten formed from flour. Could you please provide insights on the best enzyme for removing gluten, dosing methods, and how to identify the suitable enzyme variant given that proteases have diverse types? This information is essential for my project aimed at resolving pipeline blockages induced by gluten from flour in the food industry using enzymes.
I'm trying to establish the Km for different substrates for a specific enzyme, however, at every attempt a new doubt arises. This is a new field of knowledge to me, so any suggestion will be helpful.
So far I am following these premisses:
- at least 6 substrate concentrations, sometimes 7 (from 1 mM to ~ 0.015 mM) ;
- the substrate consumption should be less than 10% ( so I am testing several amounts of enzyme for each substrate and using the amount that is enough to be measured and also consumes less than 10% of the substrate, even in the lowest concentrations);
- Results of the Km and Vmax are obtained by nonlinear regression of the Michaelis-Menten curve using GraphPad Prism software.
The analysis is performed by the formation of the phosphate in the reaction (molybdate/malachite green-based assay).
Some of the problems I'm facing:
1) for some substrates I couldn't get an M-M-like curve, even when trying different amounts of enzyme or substrate. Then, I believe that the data are not adequate to perform Km and Vmax calculations. I've noticed that with these substrates the consumption is lower than than with the other ones. Any suggestion on how to improve the assay in this case?
2) for the substrates that I do get a proper M-M-like curve, many times I am not able to obtain good independent replicates. Once the amount of enzyme is not supposed to affect the Km, but only the Vmax, what else could be affecting changes in Km?
3) Also, I've noticed that for some substrates (even if the replicates are consistent) if I consider 7 or 6 different substrates concentrations the Km changes significantly. For example: using substrate from 1 mM to ~ 0.015 mM (7 concentrations) it was obtained a Km of ~ 0.30 mM; while considering just substrate from 0.5 mM to ~ 0.015 mM (6 concentrations) the Km obtained was ~0.17 mM. Someone could explain that or indicate some bibliography?
Thank you in advance!
I tried to isolate pr-FMN from UbiD like enzyme and verify it via UPLC and Mass spectrometry. The results obtained from MS shows detection of right mass but UPLC spectrum tell another story. How can I identify compound just with mass if it’s not prFMN?
your guidance will be highly appreciated.
I work in a investigation about hydrolysis of protein of a andean grain and is very important for continue with my work what method is more effective for the activation or maybe is possible not to do it?
- In the enzyme reaction with PFAS, how to stop the reaction after a certain time? (I plan to add 1 mL 0.5% methanolic ammonium hydroxide in 0.5 mL reaction solution, will it work?)
- Then I want to dissociate the enzyme from PFAS, and remove the enzyme because I need to measure the PFAS. How to do that? (I plan to freeze (-20 ℃) the sample overnight and then centrifuge it (at 4 ℃) to get the supernatant, will it work?)
As a classical biocatalyst, what is the normal range of the catalytic constant (Kcat) value of the typical enzymes? What does it mean if it's less than 1/s?
I will extract and purify elastase from the pancreatic tissues, and then calculate the optimum pH, temperature, and substrate concentration. After, I will apply different plant extracts to the enzyme to identify the inhibition effect.
my question is:
1. what is the chemical inhibitor of serine elastase?
2. what is the perfect method for extraction?
3. what is the substrate
4. what is the better method to add the plant extracts ?
For enzyme assays using cell supernatant which are slight yellow and using pnpp substrate which will also produce the yellow pnp substrate will predictably have a distortion on the absorbance. to what extent will this affect enzyme rate calculation and any papers on this?
Hello everyone,
I need a citrate buffer with an optimal pH of 4.8 for the enzymes I'm working with. I'm using citric acid monohydrate (molecular weight: 210.14 g/mol) and adjusting the pH with NaOH. I'm preparing it as a 10x concentration and diluting it to 1x in the final volume (15-200 µl).
However, I've come across recipes for citrate buffer that use both sodium citrate and citric acid.
My question is whether the buffer I'm making will be strong enough to maintain a pH of 4.8 when I dilute it to 1x in my sample. Is the recipe with sodium citrate and citric acid a better option for buffering at pH 4.8?
We are using some enzymes to test in the laboratory. Trying to figure out the best method treat the waste water. The actual chemical we using are testing with enzyme based drain cleaners. Need guidance and suggestions..
Thank you.
I'm working in a project where I need to test the enzyme activities of an insect's gut fluid. I've already tested it and found some good activity. Now I want to know whether the enzyme, showing high activity, is endogenous to the insect, or just produced by gut microbiota. There is no genome sequence or any other information available about that insect. How can I test it? How can I prepare enzyme solution, containing only endogenous enzyme of the insect?
I've read about the antibiotic feeding process. Anything else?
I found a paper where they incubated the insects for 24 hours, dissected, collected the gut fluid and then filtrated the gut fluid through 0.22 micrometer syringe filter, then demanded that this filtered solution contain no bacteria, neither their enzymes. But how can they demand there is no bacterial enzyme? If it is for starvation, then isn't it obvious for the insect's enzyme to reduce too? Can anyone provide any reference on support of this method, or concept? Please let me know.
I'm struggling in this issue and can't find any solution. I can't use the antibiotic method for a reason. Please help me out. Thank you.
What is the particle size of the cross-linked enzyme aggregates? Can the prepared cross-linked enzyme aggregates be dissolved in water again?
functionalized mesoporous silica unable to immobilise alpha amalyse enzyme
Hello,
I want to use a commercial preparation of recombinant PNGase, but I do not have the buffer. What cofactors or buffer conditions does PNGase F require? I will add the enzyme to cell lysate and then run western.
Thanks!
I completed the experiment for one of our colaborators (I measured inhibition of an enzyme by 3 compounds). Unfortunatelly compounds were not active in the range of dilutions that I had used (up to 10 micromol). Higher concentrations caused the paradoxically high signal due to (probably) interactions with the detection reagent. Therefore concentrations higher than 10 micromol were excluded and, in the end, I could not observe the full dose-dependent curves (and did not calculate IC50). If it was my publication I would left the results like this with the explanation why higher concentrations were not included. But the colaborator asked If I could "complete the curve" on the graph for one of the compounds. I would rather not do that but I consulted one of my supervisors and added dotted line in place where could be the curve (the highest concentration of compound reached ~ 50% of the maximal inhibition, rest of the curve was predicted by the program). I though, that the request was made just to make graph more pleasant to the eye. But later the same collaborator made another request - to calculate IC50 from that curve (where half was from the experiment and half was "predicted" by the program with the assumption that the compound will reach 100% of inhibition - which is not certain). The collaborator also asked to "complete" another curve (where experimental data reached only 25% of the maximal inhibition).
If it was my publication I would never do that. I do not want to suggest that I tested concentrations that I did not test and I do not want to suggest that the compounds were able to fully inhibit enzyme (which I did not prove). Also I do not want to create "artificial IC50" which could be used to compare the compound with different compounds creating false conclusions. But maybe I am wrong? Therefeore I want to ask:
Is it correct practice to "complete the curve" (to elongate the curve to reach 100% of expected effect) even if you did not test higher concentrations (because higher concentrations were to high for the assay). Is it correct to calculate IC50 from that kind of curve?
Hello everyone,
I need to use a final concentration of 90ng/uL of BSU polymerase in a final volume of 50uL. The NEB BSU polymerase specification sheet indicates 5ng/uL as the stock concentration. How do I convert units/uL to ng/uL knowing that one unit is defined as the amount of enzyme that incorporates 10 nmol of dNTP into acid insoluble material in 30 minutes at 37°C.
I am not 100% sure but I know that:
Specific activity (units/ng) = 5 U/μl / 10 nmol
To convert nmol to ng, we need to know the molecular weight of dNTP. Assuming an average molecular weight of 330 g/mol for a single nucleotide, we can calculate the specific activity in units/ng as follows:
Specific activity (units/ng) = 5 U/μl / (10 nmol x 330 g/mol)
and... if this is correct... then what?
Thanks a lot :)
I am conducting an on-going research study and I am evaluating the performance of consortium of bacteria as a biocatalyst in a microbial fuel cell. There's some misunderstanding between me and the panelist about what to call the subject the microbial fuel cell that we are assessing. Prior to our consultation, we called the MFC's as our participants. We were called out about this because according to the panelist, we cannot call the microbial fuel cell as participants because they are inanimate objects, thus, won't be able to answer the questionnaire in the pre-test and post test.
If that's the case, what is the right term to call the microbial fuel cell? And if it's not a questionnaire, what's the type of question should we ask to evaluate the performance of the MFC's?
Crosslinking on surfaces makes the enzyme reusable multiple times, I wish to know whether this is possible for a chemical reagent. Once fixed or coated on a surface, can the reagent be used multiple times for a microassay? And if this can be done, please direct me to a source. A research paper/any kind of literature would be helpful.
Hi,
I have Michaelis-Menten curves for 2 conditions (control VS disease) to look at the difference in activity of my enzyme of interest. I'd like to see the best way to quantify the difference in activity statistically. I have attached my curves. The blue + purple curves are biological replicates of control and the green + red curves are disease samples. I'd like to quantify the change in the enzyme activity.
Any help would be appreciated!
I have just started my Phd , I have to work on enzyme engineering and my previos background was quite different, for my research have studied literature and selected an enzyme santalene synthase for engineering this enzyme has the PDB structure available but when I blast the same sequence on NCBI results are showing synthetic construct with its name . what does it mean and can I use this enzyme for my research ? Your kind guidance will be appreciated. Thanks
Greetings
I am working with a plasmid encoding the restriction enzyme EcoRV.
Do you know of E. coli strain resistance to EcoRV restriction?
I am trying to carryout diagnostic digest with AatII and DraIII (Adei) but the two did not cut as expected. Could it be because of CpG sensitivity?
The tests are the paired lanes separated by blank from left to right. The first lane on the left is treated with enzyme (Bam HI, AatII, Xbal, Dra III). The second lane contains the uncut plasmid in each case.
These are not PcR products, they are plasmids from miniprep.
I'm writing a report on enzyme activity and characterisation and i need help with understanding this: we were told to report on our results for a 1/10 diluted acid phosphatase. I want to know why we need to dilute the enzyme in the first place and why not use the crude enzyme lysate?
Dear researchers
I want to ask about molecular docking in research. I have a complete research in which I isolated an enzyme. Any researcher can complete my research with theoretical calculations of the isolated enzyme against bacteria. I am waiting for the answer in order to complete the research. Greetings to all.
we know that chitosan is not actually soluble in physiological body fluid.
Hi,
I am measuring the production of 4nitrophenol at 405nm for my enzyme assay.
In the neg control (buffer + substrate) and the enzyme reaction at pH 5.5, 6.5 I observe the absorbance initially increases,decreases and fluctuates . Why is this happening?
I have attached a copy of the pH6.5 timecourse.
I have been trying to digest a vector pXMCS for the last two months but no luck so far. I have been using NdeI and KpnI (Both of them were present on the plasmid map of the vector) as restriction enzymes and incubating the reaction at 37 degrees for 5 to 6 hours. I am using buffer 2.1 which is compatible with both enzymes. Even overnight digestion does not seem to work out. I also tried single enzyme digestion reactions for 5 to 6 hours and overnight (just to check which one of the enzymes is not working) but this is what I got (2nd picture). I would love to get some suggestions on the same. Thank you.
PICTURE 1: Lane 1: 1 kb plus ladder, Lane 2: uncut vector, Lane 3 and 4: Digestion reactions (with 1ug concentration vector each), Lane 5: Uncut vector, Lane 6: Digestion reaction (3ug vector)
PICTURE 2: Lane 1: 1 kb plus ladder, Lane 2: uncut vector, Lane 3: KpnI, Lane 4: NdeI
Is there anything can be done if the insert gene contains an additional restriction site which recognized by restriction enzyme not only one restriction site at the end of gene sequence, but another at middle of the sequence. In the middle of the experiment when checking for digestion via gel electrophoresis I realize this is the case happened since I find extra band in the gel. (Insert is cut into two parts).
How can I solve this issue if I only have my designed primers for this sequence, one type of polymerase enzyme? (I dont have any other materials which are not needed for this experiment).
Inhibition of alpha-glucosidase Enzyme in invitro
I read a few articles and saw that the enzyme concentration they usually use is 0.1U or 0.2U but some articles use 1U. So which one is better and based on what factors do we choose this concentration? Thank you very much.
I need to prepare a liquid culture medium for enzyme production. Kraft lignin will be the substrate in the medium. What would be the best solvent for this?
Hello,
I am measuring thermal stability of a small protein (131 aa) using circular dichroism following the loss of its secondary structure. The data obtained is normalized to be within 0 and 1 where 0 is folded protein and 1 is completely unfolded. The CD of the fully unfolded state was calculated from a different experiment on the same batch and taken as reference. Once plotting my data in Graphpad Prism 9, I am fitting a standard 4PL curve using non-linear regression, constraining the regression to use 0 as bottom value and 1 as top value (see attached file). The Tm is reported as IC50 in this screenshot because this formula is often use for calculating IC50 and EC50. However, the resulted fitted line seems to not being able to represent correctly my data. I performed this experiment twice and the replicate test is showing that the model is inadequately representing the data. Should I look for a different equation to model my data? Or am I making a mistake in performing this regression? Thank you for the help!
Should I get certain 'fungi' or buy enzymes and use it directly for biological treatment ? Which enzymes can be used ? Where to buy from ?
I am currently trying to compile a meta analysis looking at the influence of enzyme activity of xylanase on fiber digestibility.
However, much of the research I have compiled have different enzyme units reported. The main issue is that most articles do not define U. I know the standard definition of U is defined as the amount of enzyme required to liberate 1 umol of substrate in 1 minute under standard conditions but since articles do not report this and simply give enzyme activity as XX U/kg, I have no way to compare these values. The articles also do not confirm that U is defined as international U (IU).
Was there anything I can do to standardize the enzyme activity in order to analyze the reported data? Alternatively, was there any other type of analysis I could still do with enzyme activity data and fiber digestibility?
Thank you in advance
I need information on concentration of enzyme to be used for particular amount of collagen, the buffer solutions, temperature, time, pH required for the optimal enzyme activity.
According to the papers I referred, I used 0.05M Tris-HCl and 5mM CaCl2 solution for enzyme activity but didn't seem to workout.
Hi all,
I have an anaerobic bacteria, which could utilize xylan as the sole carbon source. I tested and found that the xylan-degrading enzyme was cell-associated protein. I harvested the cell mass which growth on the xylan (incompletely soluble in broth culture) by centrifugation. The I did the sonication to break down the cell wall and release the cell-associcated protein. Then I centrifuged to collect the supernatant. I precipitated the supernatant by 40% (NH4)2SO4, centrifuge to harvest the pellet. Did dialysis overnight by 1kDa-cut-off dialysis membrane.
Then I had the crude extract enzyme. I incubate the crude enzyme with substrate were oligosaccharides of xylan, from xylose (X1) to hexose (X6). for 24h. But when I develop the hydrolysis product on TLC, the patern of spots were strange. In the hydrolysis of all sets, presence of spots at X3, X4 and X5, even in incubation of crude extract enzyme with Xylose.
Therefore, I think, the presence of X3, X4, X5 in the product enzyme reaction with xylose, might be the remaining oligosaccharide products from broth culture.
Could you give me some suggestion or recommendation to remove this remaining products from crude extract enzyme?
Thank you in advanced.
I have produced cellulase enzyme by solid state fermentation using rice straw as substrate and fungus Aspergillus flavus. I use CMCase assay method to determine enzyme activity. Now, how do i calculate enzyme activity in U/ml.
My assay method was 1% CMC as substrate in 0.05 M phosphate buffer. I used 1.8ml 1% CMC and 0.2ml Enzyme extract and incubated at 60°C for 30min. Then add 3ml of DNS and incubated at 100°C for 5min. and measured Optical density at 575nm. I made a standard curve. How do i calculate in U/ml from standard curve.
Attached picture has data obtained from activity (initial velocity) measurement of an enzyme. This enzyme is homodimeric, dimer is more active than monomer. Each subunit has two obligatory Mg2+ at its active site, maybe there are extra binding sites for Mg2+ we don't know of yet.
At [Mg2+] = 0.5 there is this inflection point, which is reproduced in experiments, and I want to make an appropriate equation to fit the data, but I couldn't find the model.
Considering all this, what kind of magnesium binding can describe enzyme behavior giving such activity curve?
I have insert having flanking regions with XbaI site and and a vector digested with XbaI. How can I prevent self ligation in insert as well as vector before ligation?
I have been trying to determine Km and Vmax of alpha amylase with the MM plot but I cannot reach the saturation point.
My substrate concentration (starch) goes from 0.1 to 3 mg/ml and in my last experiment I tried with U=0.1 for the amylase but my plot still behaves as a linear plot.
I dont know what am I doing wrong. Does any one can share a protocol where you managed to construct the MM plot for this enzyme, please?
I have insert having flanking regions with XbaI site and and a vector digested with XbaI. How can I prevent self ligation in insert as well as vector before ligation?
I need CEL1 enzyme to use it in my laboratory work to complete my PhD thesis. Unfortunately, I didn't find it anywhere. So I'm waiting for any request about companies name where is available or anyone who sell it for me.
thank you.
I performed crosslinking using a 10 mg pellet and 5 ml of diluted 2.5% glutaraldehyde for a period of 2 hours. Upon attempting to dissolve the crosslinked enzyme for activity assay, I encountered inaccurate dissolution. Moreover, when compared to the free enzyme, the crosslinked enzyme did not exhibit activity in the activity assay. However, increasing the concentration of the crosslinked enzyme resulted in activity, which is in contrast to the behavior of the free enzyme, which exhibited activity at a concentration of only 100 ng. What further steps can I take to address this issue?
Hi everyone.
In our lab we genotype samples for our experiments. Apparently we see a band/bands in our control neg ( MQ water). we have changed everything, the buffers, water, primers, restriction enzyme. but still, we see this band. I am not sure if this is contamination or not.
Do you have any idea how to solve it?
Hello,
I am trying to measure the Kd of an enzyme. I used a fluorescence-based kit and I did a dose-response for the substrate.
I measured over 2 hours the fluorescence intensity.
How am I supposed to measure Kd? and which time point should I choose?
Thanks.
Abir
If an active site mutant knocks out product formation at all excessive concentrations of substrate and at all excessive concentrations enzyme, but substrate binding affinity via anisotropy shows no difference in binding affinity for wildtype versus active site mutant enzyme, is kcat = 0? But if kcat = 0, then by the relationship of Michaelis constant (KM) to kcat then KM = KD.
How do you show to reviewers that the active site mutant is dead? If the wildtype mutant starts producing product in seconds, are you supposed to measure the reaction for the mutant for an hour at zero concentration of substrate and at 100fold excess substrate concentration of the K_M for the wildtype enzyme for the active site mutant, and show the time course?
Are there any publications that show a mutant enzyme is not just slow to produce product but is rather incapable of producing product but can still bind substrate? Examples would be greatly appreciated!
I hope someone can help me with this! I am currently working with one enzyme expressed in E. coli. We want to scale up the process to an industrial production (no Academia involved).
The regulation of E. coli BL21 cells is not clear to me. Can be used for commercial/industrial use if used for enzyme production?
If not, what other bacteria can be used instead?
If we use a pET vector system, can this be used for industrial production as well?
Any discussion, advice, or document will be very much appreciated!
Thanks
I have synthesized several compounds that only dissolved in DMSO. The problem arose when I'm doing an enzyme inhibition assay. The compound should dissolved in 5-10% DMSO, otherwise the assay cannot be done. Is it possible if i use 100% DMSO to make a stock solution of my compound and corrected the result using 100% DMSO as negative control ?
I am currently working with one enzyme expressed in E. coli. We want to scale up the process to an industrial production (no Academia involved).
The regulation of E. coli BL21 cells is not clear to me. Can be used for commercial/industrial use if used for enzyme production?
If not, what other bacteria can be used instead?
If we use a pET vector system, can this be used for industrial production as well?
We are working on monoclonal antibodies using a G1 synapt HR mass. we can take a good charge state envelope for proteins with molecular weight of less than 40 KD such as Gh hormone or CAD enzyme. However for monoclonal antibodies with molecular weight of more than 100 KD such as Ritoximab, charge state envelope has low sensitivity and resolution so that the Maxent software can not calculate molecular weight of MABs. Our instrument is 8K.
any comment is greatly appreciated.
I want to use the active site structure of carbonic anhydrase enzyme in my paper. Is it better to draw its structure myself with software such as Discovery Studio or Paymol or...? Or is it better to take this structure from other articles and use it in my article and give them a reference?
thank you
Greetings everyone.
During my master's research, I focused on exploring the potential of a specific bacterial strain to produce antibacterial compounds. To achieve this, I used the technique of liquid-liquid fractionation (Extraction) using butanol for the bacterial culture broth. Then, I subjected the supernatant to freeze-drying and further dissolved a portion of the butanol crude extract in methanol for analysis using GC-MS. The results revealed the presence of two secondary metabolite compounds, notably beta-carboline and cyclo-l-proline-l-leucine.
I investigated the genes and enzymes of the bacteria, and it appears that the genes and enzymes that synthesize beta-carboline and related compounds were not present in the bacteria. I have the genomic sequence date of the bacteria. I have searched the genome database to identify any genes or enzymes associated with the production of beta-carboline. Unfortunately, no such gene or enzyme seems to be directly related to the synthesis of beta-carboline in this bacterium. Also, my investigations regarding the McbB enzyme (which is an enzyme that works for the production of beta-carboline) have unfortunately provided no evidence of its presence in my bacterial strain.
So my question Is there an alternative methodology or approach by which I could clarify the mechanisms used by this bacterial strain to produce these compounds? For instance, the synthesis of beta-carboline usually involves the enzymatic action of tryptophan decarboxylase, which catalyzes the conversion of tryptophan to tryptamine. However, my bacterial strain seemingly lacks this specific enzyme. I am hoping that if any practical strategies or methodologies exist, I will try them as a first step to finding some answers for the synthetic pathway.
I sincerely appreciate any insights or directions you can provide.
I had extracted dna from E. Colli which shown very low digestion even with Hf digestive enzyme It is suspected that becouse of 1-3 minute kept plasmid with Pd3 during plasmid Isolation caused supercoilling of Plasmid which hindering restriction digestion
I cut a vector that already contain the promoter using BstBI enzyme. The electrophoresis gel result showed that no different between control and vector+plasmid cut BstBI enzyme. There are more than 1 band found in the gel. Does anyone have any idea why it is this way?
Hello. This year we started using ITC in a bit unconventional way to study enzyme kinetics of beta-lactamase (there is already literature data that showed it works). The principle is fairly similiar to binding experiments, the difference is that after every injection of substrate to enzyme the baseline does not return to zero, but there is a slight displacement. This differences can than be converted to reaction rates if you know the ∆H of the reaction. The biggest problem we are facing is huge inconsistency in data, especially with controls, where we titrate just substrate to buffer (see the pictures). Also, at the beginning of each titration (both enzyme and controls) we get this endothermic dips, which is weird, because dilution heat should produce exotermic peaks, which are clearly showing up after couple of injections. Anyone has clue what might be going on or have some practical advice? Some useful experimental information: we use Affinity ITC, 190 ul sample cell, 30x2 ul injections with 100s spacing.
I'm searching how to find enzyme DNA sequence.
I know what strain produce product, and I also know the biosynthesis pathway.
But I can't find how to solve this problem.
Now I'm studying some program, but it doesn't help.
What is the problem?, my ability? or my low knowledge?
Hi all,
I'm attempting to clone a GC rich insert (500bp) into a vector that is approximately 5kb and also GC rich. After sequential digests (one enzyme works at 37 while the other works at 65 degrees Celsius), a 0.5% agarose gel reveals that the vector was efficiently cut as indicated by a 500bp shift down of the parent insert vector. Oddly, the 500 bp insert is barely visible. When blown out, the gel shows a smear near the 500 bp region. Is there a reason this is occurring? We are struggling to get any colonies to appear for diagnostic digests so any help would be appreciated.
Thank you!
I used HEK293 cells as expression system, transiently transfected using PEI. Harvested on Day 4 or sometimes Day 5. The enzyme produced always show up as strong band in cell pellet in western blot , while there is no band in supernatant. While doing enzyme assay, this shows no activity.
I changed my expression system and used Expi293 cell line, which produces an active enzyme.
My questions:
1. Is this related to cell lines, but in past we have seen HEK293 cell line producing any other enzymes?
2. Does vector design plays any role in this?
Iram
Hi everyone,
sorry if this is a simple question, or if I get anything wrong here, but I'm very outside of my comfort area when it comes to enzyme activity-related calculations.
So, I need to know the concentration of enzymes that a paper used for their stock solution of Catalase.
Here is a quote from the methods: "Enzyme activities of stock solutions were 3 mM/s for GOX and 998 s-1 for CAT. To obtain a defined, stable oxygen concentration of 2% on cell surface stock solutions were diluted by 1:10,000 for GOX and 1:1,000 for CAT."
For the GOX, I think I can manage to calculate the stock, but the catalase is the issue
So, the Kcat = 998 s-1
The Vmax = 1uM/ min = 0.0166uM/ s
For for the calculation: Kcat = Vmax / E[t] , is it as simple as rearranging it to E[t] = Vmax / Kcat?
That Vmax figure is from the data sheet of the catalase, with 1 unit being equal to 1uM H2O2 processed per minute (not 100% sure this is what is meant by Vmax), hence me dividing by 60 to get the uM per second.
I also know that 1mg of Catalase = 20,000U
The issue is that I don't know how to put this all together. I am currently trying to get more familiar with enzyme kinetics, but this is taking some time. I would very much appreciate if anyone could offer some advice to help speed things up so I can start with my experiments.
If I am missing some information here please let me know.
Best regards,
Ciarán
Good morning, I am trying to degrade an RNA naturally resistant to degradation by RNases, I wanted to use MNase but it only degraded very little. My sample is in liquid medium, in 95uL of RPMI and I added 5uL of Reaction Buffer for a final concentration of 50mM Tris•HCl pH 8, 5mM CaCl2 and heated at 37 degrees for 30 min in the water bath, then I also tried it for an hour and no good results either. I have used 0.5uL (50 Units) and 1uL of enzyme.
I don't know if I'm doing it right, could you please help me, I don't know anyone who works with this enzyme, I've also tried RNAse A/T1 and the RNA doesn't degrade either. Thank you so much.
In order to perform Michaelis-Menten plot to calculate Km for oxa beta lactamase , I used nitrocefin as substrate , 100mM sodium phosphate di basic and 25mM sodium carbonate as buffer pH 7.3
Enzyme concentration 20nM
Substrate concentrations
1 uM
5 uM
10 uM
20 uM
30 uM
40 uM
50 uM
70 uM
80 uM
100 uM
Wavelength 490 nm
In order to calculate Vo ,
I plotted the absorbance values of each concentration vs time. The problem is , the slope for all the concentrations are same which means that Vo of all substrate concentrations are same.
Where is my mistake?
concentrations of the enzyme?
Concentration of the substrate?
Superoxide Dismutase Assay
Method
Activity of SOD has been determined in two ways:
1. Inhibition by the enzyme of an O2- dependent reaction.
2. Pulse radiolytic methods (Rigo et al. 1975) See: Beauchamp and Fridovich (1971); Misra and Fridovich (1972); Tyler (1975).
The method employed at Worthington is essentially that of Winterbourn et al. (1975) and is based on the ability of superoxide dismutase to inhibit the reduction of nitro-blue tetrazolium by superoxide. One unit is defined as that amount of enzyme causing half the maximum inhibition of NBT reduction. The reaction velocity will depend largely on somewhat variable assay conditions such as light intensity and reaction temperature. Calibration of the method in individual laboratories is recommended.
Reagents
- 0.067 M Potassium phosphate buffer, pH 7.8
- 0.1 M Ethylene diamine tetraacetic acid (EDTA) containing 0.3 mM sodium cyanide
- 0.12 mM Riboflavin (store cold in a dark bottle)
- 1.5 mM Nitroblue tetrazolium (NBT) (store cold)
Hi All and thanks in advance.
For long shelf life cleaning solutions, what concentration of protease and what stabilising agent should be added to hypochlorite solution content to preserve the activity of enzyme
I have received the sequence of plasmid, I aligned it with the gene sequence on APE plasmid editor and it is matched. But when I performed vector screening on ncbi, the sequence is strongly matched to vector. Can I make probe with this plasmid by cutting with relevant enzyme??
We use Hind 111 is used almost every time but why? How many enzymes do we have to choose per experiment?
Hello! I'm currently using the IntEnzyDB (https://intenzydb.accre.vanderbilt.edu/kinetics/list) for a machine learning project. During this process, I noticed that for some observations in the Kinetics Data table, the substrate_kinetics column contains multiple substrates in the form of a merged string separated by ";", which is presumably associated with multi-substrate enzymatic reactions. However, the Km entry of the wildtype enzyme sequence (column Km Wildtype) only shows one value, and the same goes for kcat. I've checked some of these reactions in UniprotKB, and there are separate Km values for different substrates. I've looked into the published paper, but I can't seem to find any relevant information. As I understand that the kinetics of multi-substrate systems could be complicated, I'd like to ask whether someone could kindly provide me with some guidance on how to interpret those entries in the database. I really appreciate your time and support!
I want to do rolling circle amplification with phi 29 polymerase enzyme . Previous article show they use 10x reaction buffer. Can I use 10X reaction buffer from thermofisher for the PCR.
I would like to performe the GRIESS reagent kit from biotium. The nitrate reductase enzyme (Sigma catalog no. N7265) has an activity ≥300 U/g. By protocol I am to use it at a final concentration of 300 U/L. The enzyme is in lyophilized powder form. How many microliters of grade water should I add? And how many microliters should I take of my solution to have final concentration of 300 U/L?
Please provide your suggestions.
I'm designing a new activity for an undergraduate biology course about enzyme activity. I'm running into a slight complication. I've ordered a lyophilized powdered version of human salivary alpha amylase.
The issue is "how long can it be stored once dissolved?".
Most protocols say to use "freshly made" enzyme. But the amount needed for a lab section is too small to weigh out. Seriously, the bottle has 1000 Units and is only 10 milligrams. Diluting to 1 Unit/mL for a working concentration makes 1 Liter of enzyme solution. That is more than enough for an entire week of lab sections!
But, will it denature/lose too much activity in the refrigerator?
Looking for some practical advice!
Hello all,
I am over-expressing acid sphingomyelinase enzyme in HeLa cells. Theenzyme shows expression on western blot but I do not have any activity in in vitro assays. I have checked the activity through Mass Spec as well as radioactivity. Please suggest where could I be going wrong? Thanks!
I want to see polymorphism of Tumour necrosis factor alpha (308 G>A, rs1800629) polymorphism. The sequence of that region is given below:
AGTTCTATCTTTTTCCTGCATCCTGTCTGGAAGTTAGAAGGAAACAGACC
ACAGACCTGGTCCCCAAAAGAAATGGAGGCAATAGGTTTTGAGGGGCATG
[G/A]
GGACGGGGTTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCA
GAAGACCCCCCTCGGAATCGGAGCAGGGAGGATGGGGAGTGTGAGGGGTA
So, I need a restriction enzyme which will cut on the bracket region in presence of either adenine or guanine. Most of the articles, I have Found that NcoI enzymes have been used for this purpose.
NcoI enzyme cleaves when this sequence present:
5' C ↓C A T G G 3' 3' G G T A C ↑C 5'But this sequence is not present in the above sequence . Rather the sequence is "GCATGG" As a result when I am using tools to find out restriction enzymes, NcoI enzyme shows" 0" cut. I did not not find any other restriction enzymes also which will cut on that site.
So, my questions are: What may be the possible solution? Where I am doing mistakes on searching?
Hello, so i am scaling up a 10 L biorector to 1000 L bioreactor for enzyme production using corncob-based media. The product increased, but there's a lot of excess media left in the product. So, i want to minimize the media impurities before purifying the product. What should i assess regarding this matter? Thank you
One Thing, Your Physics Book Many Equations Depend On Uniform Velocity And Acceleration Equation But Nothing Is Uniform All Time And Change Should Be And Must Be Come Every Where In Universe About Velocity And AccelerationAt Physics Books Those All Uniform Velocity And Acceleration Can Be More Or Less Correct For All Uniform Velocity And Acceleration World But Not For Practical Life Equation Cause Nothing Is All Time Uniform In This Life And In Heaven Also.When Moment Change And Time Change And When There Are Day,Night,Morning,Noon,Afternoon,Evening,Night That Moment Change Sky,Cloud,River,Pond,Mountain,Rain,Storm,Breeze,Drizling,Cats And Dogs And Others Then Also Velocity And Acceleration Of Life And Planet Change And When Mass Increase.Without There Would Not And Will Not Life Beauty.Life Would Be And Will All Time Alike And All Time Uniform And No Taste And Color Of Life.Kids Would Be Forever Kids,Parents Would Be Forever Parents. Universe.Its Research And Scientists Say Planets Movement And Rolling Never Follow Isac Newton Equation And Isac Newton Rule
Newton”s First Law:No Outside Force Motionless Elements Forever Motionless But Motion Elements All Time Motion.
Ans:Wrong Because No Outside Force Elements Has Inside Force.And Others Wise Actually Elements Are Not Only Electron,Proton,Neutron And Every Elements Has Different Characteristic And That’s Why Chemical Characteristics Different And That’s Why Their Strength And Characteristics Different And That’s Why Elements Not Only Electron,Proton,Neutron And There Are Many Atom Just Like Electron,Proton,Neutron That’s Why Characteristics Different And That’s Why Different Different Elements.There Are Many Atom(More Than 150 Atom Inside Every Chemistry Elements And Its Atom Number Is Vary Elements To Elements-If We Are See Chemistry Nucleaus And Chemistry(Organic Or Inorganic) Elements Or Reaction Under Plasma Microscope Or Satellite Frequency Microscope Or Very Strong Microscope Than We Will Be See Totally Different World Of Chemistry Which Is More Or Less Totally Different From Our Chemistry Book And Also Never Ever Only Chain Reaction Happens In Organic Chemistry.And Chemistry Nucleas Is That Which Secret Frequency And Secret Vein Just Like Leaf To Compact Others All Atom And Under Plasma Microscope Or Satellite Frequency Microscope We Will Be Able To See Accurately Nucleus Which Secret Frequency And Also Vein Just Like Leaf To Compact All Atoms.Nuclues Is Never Proton And Neutron…..If Nucleaus Is Only Proton And Neutron Than When Environment Partial Reaction Will Be Happen And Temperature,Air,Light,Color And Environment Different And Fraction Will Be Come Than When Proton Will Be Go Away And All Over Atom Distribution Will Be Broken And All Will Be Broken.So,There Are Many Atom Inside Elements. . Chemistry Basic Atom Not Only Electron,Protron Or Neutron And There Are Others Basic Atom Within Elements And That’s Why Characteristic Different And Vary Places To Places.Changeno Atom,Airono,Waterono,Cloudono,Massono,Environmentallono,Specifino,Tastetono,Reactono And Others Many Atom(Just Like+_*%#!) Within Elements And It Is Vary Environment To Environment And Places To Places Or Planet To Planet.Atom Distribution Equation-----q*v*theta(sin,cos,tan or others)/Time Or Changing Time----Here---q=Atom Charge---Velocity----Theta---Atom Position With TimeIf We Are See Chemistry Nucleaus And Chemistry(Organic Or Inorganic) Elements Or Reaction Under Plasma Microscope Or Satellite Frequency Microscope Than We Will Be See Totally Different World Of Chemistry Which Is More Or Less Totally Different From Our Chemistry Book.And Chemistry Nucleus Is That Which Secret Frequency And Secret Vein Just Like Leaf To Compact Others All Atom And Under Plasma Microscope Or Satellite Frequency Microscope We Will Be Able To See Accurately Nucleus Which Secret Frequency And Also Vein Just Like Leaf To Compact All Atoms
Now Without Outside Force Motionless Elements Never Forever Motionless Or Motion Elements Never Forever Motion Because They Have Specific Characteristics And Inside Temperature, Pressure And Atom Elements Just Like Electron,Proton,Neutron And They Will Do Reaction And Others Velocity And They Have Half Yearly Age Because Every Elements Should Be Do Reaction And Die Or Convert Or Change Because Planet Mass Increase Everytime And When Only If Single Something Change Than Change Everything.So,Aisac Newton Equation Should Be Wrong.Aisac Newton Equation Can Be True That Time When There Would Be No Constellation Or Universe Because Change Should Be Come Today Or Tomorrow And Every Time Because Nothing Is Uniform Velocity And Acceleration Here And In Heaven Life Forever.
Solve Equation:No Outside Force Motion Elements Can Be Motion But Once Inside Electron,Proton,Neutron And For Others Basic Atom Like Airono,Pressurono,Timeno,Frequencyiano,Reactionon,Relationono,Rationono,Waterono,Environmentolono And For Others Basic Atom Motion Elements Can Be Do Reaction And Once Motionless And It Can Be Slight Motion Increases But Once Motionless Cause There Are Many Many Basic Atom In Environmental Elements And Their Ratio And Velocity Different And That’s Why Characteristics Different And Sometimes Vary Place To Place Or Place And Distance Change And They Have Half Yearly Age And Environment Has Recycling Process And Partial Reaction And Its Gonna Convert Others Like Dhancha Plant When Die Then Convert As Green Fertilizer.And Same Words For Motionless Elements.And Motion Elements Never Wanna Forever Motion And Motionless Elements Never Wanna Forever Motionless Cause It Has Utter Energy And Basic Atom Reaction And Velocity And Ratio And Environmental Partial Reaction And Recycling Process For Life.
Now,Suppose Anything Is Motion And No Outside Force:Motion Elements=Total Unit( Time And Others)*Summation Of Velocity*Inside Utter Energy Change*(Like Basic Atom Ratio And Velocity Change And Environmental Partial Reaction And Recycling Process Change)=Last Step Can Be Motionless Or Sometimes Slight Motion Increases And Once Inert Elements And Scattered………… And Here Elements Came From Environment.And Motion Less Elements Will Be Slight Motion And Once Scattered And Equation Motionless Elements=Total Unit( Time And Others)*Summation Of Slight Increases Velocity*Inside Utter Energy Change*(Like Basic Atom Ratio And Velocity Change And Environmental Recycling Process Change))=Last Step Can Be Motionless Or Sometimes Slight Motion Increases And Once Inert Elements And Scattered.
Newton 2ndLaw:Force Proportional Momentum Change(Wrong)
Ans:When We Give Force On Elements It Can Be But Elements Has Also Own Force And Momentum.Example:Suppose Two Things Running:
M1=2, M2=50
V1=3,V2=80
K1=3,K2=80
So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.
Solve:Force And Momentum Change Depends On Elements.Suppose One Ball When You Will Be Kick Then It Will Get Easily More Velocity But When You Will Convert Same Ball To Any Sheet And Give Same Force Then Its Momentum Change And Both Momentum Change Should Not Be Same.And Force And Momentum Change Depends On Elements And Size And Environment Also.Suppose You Are Wanna To Fall One Thing From Mountain Then Just Touch And It Will Be Get Huge Force And Velocity But Your Force Was Very Slight And If You Will Give Same Same Force On Normal Environment Then It Will Not Get Same Velocity And Force.So,Its Depend On Environment And Environmental Recycling Process.
Equation:F1=M1*Dx1/t1 And F2=Dx2/t2 Now After Accident F1*F2=M1*Dx1/t1*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)*M2*Dx2/t2
Now F1**(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)=/<_(Not Equal)>_(Not Equal)F2*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)
Newton 3rdLaw:Every Force Has Equal And Opposite Force(Wrong And It Can Be True For Slight Time But Not All Time) Ans:When We Give Force On Elements It Can Be But Elements Has Also Own Force And Momentum.Example:Suppose You Are On Mountain And Just Touch A Big Stone By Finger Which Will Be Go To Touch Soil And Get Huge Force When Newton Under Apple Tree And Break Newton Head.So,What Will Be Opposite Force Of Newton Broken Head.Or You Are Pushing A Pin At Wall By Hammer…Pin Is Going To Wall But Hammer Does Not Get Same Opposite Force.Suppose Two Things Running:
M1=2, M2=50
V1=3,V2=80
K1=3,K2=80
So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.So,Elements Force Should Not Be Equal And Opposite. You Are Giving A Kick To A Truck And Truck Has No Reaction Force But Your Leg Is Broken.Truck Not Give Same And Equal Force.Newton Gave Bullet And Gun Equilibrium Force Equation But Now Many Bullet Donot Give Opposite Force After Release.And Same Equation For Boat Also.And I Am Giving Something Fall From Moutain Or Foorball Or Truck Velocity And Acceleration Equation.
So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.So,Elements Force Should Not Be Equal And Opposite.
Equation:F1=M1*Dx1/t1 And F2=Dx2/t2 Now After Accident F1*F2=M1*Dx1/t1*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)*M2*Dx2/t2
Now F1**(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)=/<_(Not Equal)>_(Not Equal)F2*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)
Newton Gave Bullet And Gun Equilibrium Force Equation But Now Many Bullet Donot Give Opposite Force After Release.And Same Equation For Boat Also.And I Am Giving Something Fall From Moutain Or Foorball Or Truck Velocity And Acceleration Equation.
And For That Motion Of Rocket Equation Was Wrong Because It Was Depend On Newton”s 3rdLaw: When You Will Be Go From Soil To High Sky Than Gravitational Attraction Increase That Velocity Decrease But Once Near Unventilated Places Gravitational Attraction Decrease And Rocket Velocity Increase And Plane And Rocket Different Things But Alike.And Free Velocity Should Not Be All Time 9.8 ms-2.And It Should Be Different Elements To Elements Either Up And Down.So,When You Are To Go Up Than Every Second Before Reached Unventilated Place Velocity Should Be Decrease For Gravitational Attraction.
Motion Of Rocket:
Rocket Mass:M
Gas Mass: Δm (Delta Mass) In Every Seconds
One Second Gass Mass = Δm
Δt (Delta Time) Gass Mass= Δm (Delta Mass)/ Δt (Delta Time)
Now Force F=Ma
HERE, M=Rocket Mass
a=v/t,
Δm (Delta Mass)/ Δt (Delta Time)*t
.
Force=M(Rocket Mass)* Δm (Delta Mass)*Increase Gravitational Attraction That Deacrease Rocket Velocity With Environmental Temperature And Pressure And Others And Increase Velocity By Force With Environmental Temperature And Pressure/ Δt (Delta Time)
So,HereGass Mass Should Be Higher Than Or Bigger Than Rocket Mass And Everything Seconds It Will Change For According To Environment.So,Newton 3rd Law Should Not Be Work Here Beccause It You Are Use Newton 3rd Law Than Rocket Shuttle Should Be Broken For Environmental Pressue And Temperature And Rocket Should Be Fall From Sky.
Now Neednot And Shouldnot Use Rocket.Now You Can Use My Triangle Vehicle Which Will Be Go Electric Recycling.IDonotKnow,You Will Be Albe Or Not My Triangle Vehicle Cause It Has Very Sharp Design.You Can Try But May Be You Cannot Make My Triangle Vehicle Which Will Fly In The Sky,Run On Road,Swim On Water And Dive Under Water.And.You Can Try But It Has Very Sharp Design
Now………1.Anything Is Running That Motion And Last Point Reached Equation:
Let,Suppose One Thing Is Running On V Velocity
After One Second(1s) It Will Be Go=V*1
Now T Second It Will Be Go=V*T But Now What Will Be Its Velocity Change And Equation:
In One Second=V*1 That Dx1/t1 Now 2 Second It Will Be Dx2/t2 And 3 Second It Will Be Dx3/3 And 4 Second It Will Be Dx4/4.Now Dx Can Be Change From 1 Second Or 2 Second Or 3 Second Or 4 Second.Now What Will Be Motion Elements Reached Point Equation After Time:
It Will Be Dx1/t1+Dx2/2+Dx3/3+Dx4/4 That 4Seconds*Summation Mean Of Velocity Change Or Velocity Summation (Dx1/t1+Dx2/2+Dx3/3+Dx4/4) That 4*Summation Mean Of Velocity Change And Others All Plus In 4 Seconds.
That((Dx1/t1+Dx2/2+Dx3/3+Dx4/4).
So,Specific Point Reached Equation After Time And Velocity Change Will Be
Specific Point Reached=4*Summation Of Mean Of Velocity And Time Change That Distance And Time Change And Others All Plus In 4 Seconds.
Specific Point Reached=Total Unit(Time And Others)*Summation Of Velocity
And Specific Point Reached Mean Velocity=Total Unit(Time And Others)*Summation Of Acceleration(Acceleration Mean Change Of Velocity That Distance And Time Change)
So,All Time Changing Velocity(Not Uniform) And Acceleration Equation Is:
V1+V2+V3+V4+V5 And a1+a2+a3+a4+a5
SPR=Total Unit Or Total Time*Mean Summation Of Velocity Or Acceleration.
Now Last Velocity When Velocity Change All Time More Or Less.So Last Velocity And First Velocity(Not All Time Uniform):
SPR=V1+3*Mean Summation Of Three Velocity+V5
Now,S-3*Mean Summation Of Three Velocity=V1+V5
S-F(F3MSTV)=V1+V5
Now v5=E-V1…….Here (S-F=E)
Motion Of Falling Elements:
1stVelocity=0 But When Fall From Upper Sky Velocity Low But When Fall From Near Soil Velocity High For Attraction Cause(Lower Portion Gravitational Attraction Is High).
Suppose Falling Fruit From Ifel Tower Head And Every Meter Per Second ms-1 Velocity Increases Not All Time Alike 9.8 Ms-2. Cause Its Also Depends On Environment And Elements.Its Also Not Possible For All Uniform Equation Cause Elements To Elements 9.8 Vary.
Here Suppose Vo=0 Now Vo+V1*1+V2*2+V3*3(Here Velocity Increases With Fall Attraction)
Now Last Velocity Will Be=Vo+Increases Attraction*Summation Of Mean Velocity
Suppose Increasing Attraction Velocity=g
So,Last Velocity Will Be=Increases Falling Attraction*Summation Mean Of Velocity*Total Time+Vo
So,Last Velocity Will Be=Mean Increases Falling Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo (Some Error Can Be Come But Error Should Be Identify)
And So,After Soil Touch Velocity Equation Will Be=(V-Last Velocity Increases Attraction After Touch)=Increases Mean Falling Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo
(If Need You Can V-LVIAAT Or V+LVIAAT)After Touch AsNecessity.Here Vo=0 Others Can Be
Now Last Velocity And Distance Equation Will Be That After Soil Touch Falling Elements Equation Will Be=Vo+Summation Of Mean Velocity*Mean Increases Falling Attraction Velocity*Total Time+Velocity-Last Velocity Increases Attraction*1unit
From Soil Low To High:VelocityDesreases With Gravitational Attraction But Once Near Two Point Of Planets That Near Unventilated Places Velocity Increases
That SPR=Vo+Summation Of Mean Velocity*Total Time Unit*Decreases Attraction Velocity+(V+Last Velocity Decreases)*I Unit.
Laws Of Static Friction:
1.Motionless Varnish React Inverse Of Elements Motion
Ans:It Can Be True But Not All Time.Suppose One Boat On River.And Boat Is Motionless But River Water Wave Velocity Increases For Air Environment.And Environment Has Changing And Recycling Process.So,Boat And Water Varnish Both Velocity Also Increases.So,Equation Is Going To Be Wrong.Now It Can Be Sometimes True Or Many Times Also Like Cycling On Road Or It Can Also True Motion Increases But Mass Huge And That’s Why Gonna To Be Slow Or Stop.
Equation:Motionles*Varnish Force*Last Velocity Will Be=(V-Last Velocity Increases Or Decreases Attraction)*Increases Or Decreasing Attraction*Summation Mean Of Velocity*Total Time+Vo
=(V-Last Velocity Increases Or Decreases Attraction)*Increases Or Decreases Mean Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo …..Here Vo Can Be=0 Or Others
Equation2:Motionles*Varnish Force Proportional To Stop Or Obstruct Force
Ans:How It Can Be True Cause Water And Boat And Mountain Or Truck Or Cycle Or Football Example.Cause Sometimes Can Be Increases Or Decreases
Equation Just Like 1st And S1=U1VI And S2=U2V2 And So,Here Not Proportional.
Equation3:Angel Of Repose Proportional To Last Border Varnish
Answer:Suppose One Boat On Rivet Or One Oil Machine Machine By Cow.If You Will Be Give Slight Force On Boat Border Than Its Move More Cause Lower Touching Portion Varnish Is Soft And It It On Soil Or Muddy Then It Would Be Give More Force To Move.Suppose Football Player Corner Kick,ItsGonna Here And There And Many Times Not On Specific Cause Environmental Cause Air,Temperatire,Pressure And Own Utter Energy Cause.So,Its Depend On Environment And Utter Energy Of Both Elements.
Equation Like Before And You Can Use My New Mathmatics Equation But It Can Be Increases And Decreases As Necessity And Length And Angel Can Increases And Decreases And But It Will Be Very Helpful For Cow,Goat,Horse That Animal Organ Convert For People Like Bones,Eyes If You Are Modify And Change Them 2 Or 3 Places Or More As Organ Then You That People Can Use Those Normaly But Need Plant And Plant Enzyme And Others Enzyme And Color Convert Also.
Equation4:Varnish Mean Never Depends On Touching Places And Volume
Answer:Its Ultimately Wrong If You Read My Previous Upper And Others Equation.
Equation5:Varnish Mean Never Depends On Area
Answer:UltimatelyWrong.Cause One Big Thing And One Small Thing Varnish Should Not Be Same And Also Depends On Both Area And Environment Also Like Water,Desert,Normal,Pitch Road Or Normal Village Road And Environment Also.
I Am Giving You Roult Law Example:
When 2 kg Ice+2kg Water Convert To Water Then Its Is 4Kg But According To My Law When 2kg Ice+2Kg Water Convert To Water Then It Can 4.10 Or 3.90 Or 4.20 Kg Cause Environmental Elements Enter Within It.LikeTemperaure,Pressure,Light,Master Force And Others And Why ItsGonna To Be Convert Without Why It Will Be Convert.And When Enter Something Within And React And Then 2+2=4 Kg Should Not Be 4 Kg And It Will Be 4.10 Kg Or 3.90 Kg Or 4.20 Kg Depends On Environment.So,NewRoult Law Will Be According To Me: (n2+n1)/n1=D(P2- Or + P1)/P1
Or (n2+n1/n2)=D(P1- Or + P2)/P2
Or (n1+n2)=D(P1- Or + P2)
Or (n2+n1)=(P2- Or + P1)D………Here P1 And P2 Next Situation Of n1 And n2. D=K And According To My Previous Equation K=Pressure*Temperature/N(Atom)*Volume Or D=K That K=Temperature*Pressure/Volume
Graham Law: Motionless Pressure And Temperature Any Gas Diffusion Per Inverse Density Rot
Answer:Gas Diffusion r=KTPD/Delta Time Here K=Increase Or Decreases With Temperature And Pressure Like Attraction Or Repulsion Equation
MarkonicovLaw:R-CH=CH2+HX …..Here (=)=Two Double Bond Now Solve Equation Will Be R-CH-H-CH2-X It Will Be True Equation Reaction Cause Asymmetrical And Unconnected Or Not Related.
Now You Can Think All About Your Study Equation They Are True Or Not And There Are Fit For Life And Environment Not Cause I Guess They Are Not Fit For Environment And Life Cause All Uniform Velocity And Acceleration Equation And Modified Equation Which Is Not Fit For Life And Forever Cause Here And There And In Constellation Or Universe Nothing Is Uniform Velocity And Acceleration Equation.People,Vehicle And Planet And Constellation And Universe Never Walk Or Run Or Motion Or Motionless As Uniform Velocity And Acceleration Equation.ItsGonna Change When Time Change Or Mass More Or Less Change And Moment Change Like Strom Is Not Uniform Velocity,Tsunami,Rain,MoonLight,Sunlight,Vehicle And Others Nothing Is Uniform Velocity And Acceleration Motion Or Motionless But All Your Study Equation Uniformly Go.I Am Solving According To My Own.ButIts Your Matter Accept Or Not.Now You Can Think Your Own Way And Try To Solve If You Are Guess They Are Wrong.
And Albert Inestine And Salam Glass And Stephen Hocking Equation Wrongly Prove From My Plant Energy,Fragrance,Color And Others Planet Light Absorb Or Mine,Pit,Quarry Find Equation. .............Are Those True About About Uniform Velocity And Acceleration Equation And About Isaac Newton Equations Wrong & Error?.........Please See Attachment For Further Attachment And Discussion.
Dear colleagues,
For genomic library preparation we need to obtain Tn5 enzyme. Unfortunately, In-house-produced Tn5, which was purified on Ni-column, has a nuclease activity without loaded adapters. Сould this be due to the incomplete enzyme purificatoin from the gDNA using PEI? Is this related to accidental nuclease contamination?
Dear All,
Hope are you doing well.
I am working on beta lactamase inhibitors. I have beta-lactamase-producing bacteria and i will have to check the concentration and enzyme activity for beta-lactamase using nitrocefin. Kindly share the protocol for the same.
Thank you
detailed explanations and procedures if any
Anyone have any experience using the EnzChek pyrophosphates kit in the presence of citrate. There appears to be something strongly absorbing at 360 nm prior to the addition of the last enzyme (PNP).
Hello, I am planning an experiment to measure enzimatic activity, and i will take sample every 24hrs. The only problem is that substrate is non soluble... nevertheless, enzyme can still access to it. My idea is to keep the reaction on movement, but i would like any suggestion on how to lessen error when taking the sample, because last time i tried doing separate reactions in different tubes for each measure (e.g. i had 3 different tubes for T0, 3 dif. tubes for T2, and so on), but replicates wheren't as much as similiar as I expected them to be. My first thought was to make a reaction stock (on triplicate), and take a volume of it each time, but I believe that since the subtrate isnt soluble, each time I take a sample, subtrate might vary, and i will still get error...
Is there an alternative for this type of experiments?
If not, which way is better: a stock reaction or multiple reactions?
Thank you in advanced for reading.
I am working on Nitrocefin assay for screening of beta-lactamase inhibitors and for that I would need to generate the standard curve using Nitrocefin. For my assay, I would be using crude beta-lactamase enzyme and inhibitor which will be incubated and later Nitrocefin will be added and evaluated using microplate reader at 490nm. Can I plot standard curve using Nitrocefin (fixed concentration) with enzyme unit (varying concentrations) or Is there any other methodology ? Please suggest as I am not using any readymade kit and need to develop a simple working procedure in a lab.
We digested pUC57 with the XcmI enzyme, and a non-specific band at 1500bp appeared alongside our intended band (2750bp). To diagnose the issue, we attempted gel purification on both the digested and undigested products, but received the same result. Additionally, we tried heating the digested and undigested products to dissolve secondary plasmid formation, but the same result occurred.
is there anyone with same issue who can help us please?
Antibiotic resistance , enzyme production are types of screening method . Both have advantages and disadvantages so , in these two which method is more preferred to insert in vector and provides maximum results . Are there any considerations of these methods while performing gene cloning?
All other aspects of how the simulation runs is ready. I am now creating a class in python called "Enzyme", however the following problem is not yet solved:
In BRENDA I have found the Kcat and KM values for ATP and glucose for hexokinase. In this bisubstrate reaction, how can I compute the reaction rate if I know enzyme, ATP and glucose concentrations? The problem I have is that I need to get Vmax from somewhere but for bisubstrate reactions I cannot compute Vmax from Kcat (because there are two).
Is computing Vmax as the enzyme concentration multiplied by the lowest Kcat an option?
Am I making a mistake by using Michaelis-Menten kinetics?
All help is welcome and appreciated :)