Science method
PCR - Science method
PCR is an in vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Questions related to PCR
I did BLAST of the two cellulolytic species and one lignolytic species of bacteria after 16S amplification using PCR. However, my results indicate that the lignolytic organism is 100% similar to two different bacterial species. BLAST have only identified up to the genus level in my cellulolytic bacterial species. Can anyone assist to explain what has happened?
In my undergraduate research project, I require an integrative plasmid containing GFP with an antibiotic resistance that can't be kanamycin. In our lab, all of our integrative-GFP-containing plasmids are resistant to kanamycin, so we decided to switch it's resistance using Gibson Assembly. The plasmid in question is called pL5-GFP and the KanR version (vector) was amplified by "reverse" PCR. The insert (HygR) was also amplified by PCR with 15 complimentary base pairs, and they were combined using the Gibson Assembly kit. The confirmatory PCR's (using the same primers as before) were positive, but after transformation, the mycobacteria recovered wasn't green. Then, we decided to do an restriction analysis, whose agarose gel showed inconclusive bands, which suggest that the new pL5-GFP-HygR is smaller than the KanR by approximately 3kb. I don't know what to improve in the case of starting over or what other techniques I could use. Any insights are helpful. Thank you.
ps. pL5-GFP-KanR successfully turns mycobacteria green.
How can you regulate the number of random inserted mutations in error prone PCR?
Hello,
I am making some plasmid constructs via Inverse PCR and T4 enzyme ligation.
I started with a plasmid that housed nucleotide sequences for two fused proteins. My goal was to cut out the nucleotide sequence for just one of the proteins.
For my Inverse PCR primers, I designed the forward primer to be at the beginning of the desired protein. The primer was 35 nucleotide long
I designed the reverse primer to be 34 nucleotides long. It included the vector sequence just before the undesired protein.
After amplification with inverse PCR, I ran the sample on the gel and if the band was correct, I purified the DNA from the gel.
I then added I 2ul ligase buffer and 1ul T4 PNK and incubated it at 37C for 30 minutes. Then I let it sit at room temp for 5 minutes before I added 1 ul ligase.
Then I left it at room temperature for a few hours and before I stored it in 4C overnight.
I have done this process before and it has worked for me. However, I keep running into an issue where I continually have a one nucleotide deletion right at the site of ligation.
For example,
If I want this sequence: ATGCAC
I will get this sequence instead: ATCAC
That "G" is right at the junction. For some reason, it continually gets deleted during ligation.
I was wondering if anyone has any suggestions on how to prevent this from happening? Maybe there is something wrong with the procedure that I am using to ligate?
I am doing my undergrad thesis that requires me to do PCR-RFLP analysis on DNA that I extracted from some blood samples. Initially, I was using the Qiagen mastermix for the optimization of my entire process using just 6 samples out of 100 samples. I successfully completed my optimization step, and got my desired results for those 6 samples. Once I have the measurements of the entire process i.e the amount of mastermix, forward priner, reverse primer, DNA template, and nuclease-free water along with the optimum annealing temperature for my selected primer, I proceeded on to doing the exact same thing on the remaining 96 samples serially. But I started encountering an unexpected error. For some reason, I started getting a faint band in my negative control(which only has nuclease-free water and no DNA template). At first I thought any of the reagents were contaminated, so I conducted a series of PCR reactions where in one I would use a freshly new mastermix, another time a fresh made working solution of primers and also an intact nuclease free water. In every PCR, I am getting a band in my negative control. Today I also tried using a mastermix of an entirely different company i.e. Takara Bio, but got the same results. I am just frustrated at this point. Can anyone help me figure out what is happening? How can I troubleshoot this and complete my thesis!
I synthesized cDNA from my RNA sample that prepared with Trizol. I got the ratio 260/280 in about 1,6. When I was running the PCR to check the primer that I have designed before, I got the smear on my electrophoresis gel which are not as I expected, because the product seems bigger than it should be. I designed primer with product length around 150-200, but the bands appeared in about >300. And for my housekeeping gene, 18S, there were bands in my RT+, RT-, and -ve. So I decided to do DNAse treatment to get rid off the DNA contamination.
But, when I repeat the PCR protocol again, I only got the band for 18S primer on my RT+,RT-, and -ve, while the other primer seemed not work.
What should I do now? Need help since I am new in this field.
I am doing my undergrad thesis that requires me to do PCR-RFLP analysis on DNA that I extracted from some blood samples. Initially, I was using the Qiagen mastermix for the optimization of my entire process using just 6 samples out of 100 samples. I successfully completed my optimization step, and got my desired results for those 6 samples. Once I have the measurements of the entire process i.e the amount of mastermix, forward priner, reverse primer, DNA template, and nuclease-free water along with the optimum annealing temperature for my selected primer, I proceeded on to doing the exact same thing on the remaining 96 samples serially. But I started encountering an unexpected error. For some reason, I started getting a faint band in my negative control(which only has nuclease-free water and no DNA template). At first I thought any of the reagents were contaminated, so I conducted a series of PCR reactions where in one I would use a freshly new mastermix, another time a fresh made working solution of primers and also an intact nuclease free water. In every PCR, I am getting a band in my negative control. Today I also tried using a mastermix of an entirely different company i.e. Takara Bio, but got the same results. I am just frustrated at this point. Can anyone help me figure out what is happening? How can I troubleshoot this and complete my thesis!
The 260/280 ratio is ok between 1.8 and 2.0 however we were unable to advance due to the 260/230 ratio
The last couple of months I've been trying to replicate a small part of the DNA by using PCR. While everything was working great at first the PCR just stopped working one day. I haven't changed anything regarding the components nor the procedure and I really can't figure out what happened and why it's suddenly not working at all. Any help would be greatly appreciated.
Dear experts,
I am planning to generate a large numbers of Illumina libraries in an ongoing project. These will be amplified via a single PCR step, in which the indexed adapters are added to the PCR primers. Can I just order such primers as normal PCR primers including the indices or will their quality be insufficient for NGS application (regarding index hopping etc.)? The commercially available kits for indexing are very expensive.
I would be very grateful if anyone who did this already could share some experiences. Kind regards and thank you in advance, Matthias
PS:
In case more information is required, this is the PCR protocol which I am trying to run:
We use DpnI to digest PCR product(already purified),then after digesting,do I need purified again?
Hi everybody,
I have tried to make my home-made master mix for our laboratory. I have used two type of dyes , cresol red and Bromophenol Blue(BPB). I see when I use BPB my PCR is inhibited but no inhibition is observed for cresol red.
Have anyone had the same experience? Do you think the pH of BPB need to be adjusted before use? when I add BPB to my colourless master mix in the proper concentraion it return to blue so I think pH readjustment of master mix buffer is not needed. How do you think ?
Hello fellow researchers,
I am currently encountering significant challenges in a classical cloning procedure and am in need of your expertise. Here is a brief overview of my process:
- Amplification and Digestion: I successfully amplified a 900 bp gene and confirmed its size via agarose gel electrophoresis. Both the PCR product and the new vector were digested with SpeI and PstI. The expected size of the digested insert is approximately 850 bp.
- Gel Extraction and Ligation: Following digestion, we extracted the fragments from the gel (image linked below for reference). We performed ligation at vector:insert ratios of 1:3 and 1:5, after treating the vector with alkaline phosphatase and a subsequent heat deactivation step.
- Transformation and Screening: We transformed the ligation mix into E. coli and included a negative control consisting only of the treated vector. After plating, both the experimental and control plates showed significant colony growth. We conducted colony PCR using primers specific to the insert (as verified by the first PCR to amplify the new gene of interest, but only detected the presence of the initial plasmids, suggesting issues with either religation or incomplete digestion.
Image of Gel After Digestion: Image attached
I am also curious why, despite the removal of the insert during vector digestion, there is no apparent reduction in size on the agarose gel. Additionally, running lower concentrations on a new gel seems to still indicate the original size (6500 bp) and the absence of a double band (second image).
Given this context, I am puzzled by the overgrowth of the negative control and the absence of the insert in PCR screenings. Could there be an overlooked factor in the ligation or transformation steps that might explain the high background of vector religation?
I would greatly appreciate any insights or recommendations on potential adjustments to my protocol that could help in achieving successful incorporation of the insert. Could there be additional checks or modifications to ensure the effectiveness of the phosphatase treatment or the ligation efficiency?
Thank you in advance for your assistance!
My fellow Academic colleagues!
I together with my lab mates have a PCR-related issues that we hope that some(one) of you might have encountered and hopefully solved.
In “short”, our initial PCR (MiniAmp Plus thermocycler) and electrophoresis protocol works like a charm – the latter somewhat modified. We obtain weak to strong band that yielding concentrations of 9 to 20 ng/µl following clean-up using the QIAGEN QIAquick PCR (& Gel) purification/Cleanup Kit (with an acceptable A260/A280 ratio). We obtain rarely, but from time to time, a positive electrophoresis confirmation. But as we are using the same protocol for the confirmation, as for our initial PCR, we should have no issue confirming our results (one band per week).
Usually, when we try to confirm our cut-out electrophoresis bands, running a PCR on our cDNA, something fails. We utilize the same primers and protocol, as for the initial PCR, but nothing shows up in our gel, our at best a streak. We’ve tried renewing our primer mix(s), new isopropanol, new buffers, using both RNAse-free water and the included buffer, modifying temperatures (thermocycler), number of cycles, and using the original non-modified protocol. But nothing results in an electrophoresis band when we try to confirm our initial band.
Thank you for your insights and help!
// Eriksson et al.
I am running a DNA PAGE after PCR (samples 6-15 are run in duplicate with the second sample digested) to determine serotonin genotypes. The ladder (well 1) is on the far right of the attached image). I would greatly appreciate any advice on how to enhance band brightness and definition, thanks.
Additional information: 5 uL ladder added, 10 uL PCR product per well, PH of the buffer is correct. Temperature of the room ~75F with Gel container NOT on ice.
I want to do PCR amplification with my full-length gene and the addition of P2A fragment at the end of my gene. However after doing PCR, I run gel electrophoresis for analysis. But it doesn't include the band for my gene. I run the same template DNA with other primers for smaller fragment, and it has the band. I tried to redesign my primers for full-length fragment, but it still don't have the band for my gene. Can anyone help me? Thank you
I use a Q5 polymerase to amplify a 7 kb fragment from a genomic DNA but get no results.
I use the stated protocol in NEB website. Any suggestions to modify the PCR protocol so I can get the amplification?
I have the PCR products of two bacterial genes (gyrA=1024 bp and rpoB=808 bp) and I want to know how many microliters I should add in the agarose gel?.
I have been using NEB Hifi Gibson assembly for a couple years now and I've been quite happy with it. I regularly make plasmid constructs with 4-8 fragments, and always >1/4 of the colonies are "perfect," while the remaining ones may have some SNPs at the joining sites, or be misassembled due to a repetitive region.
Some colleagues said that Golden Gate has even higher efficiency. That even with 8 fragments, it is normal for 50-100% of colonies to be perfect. Is that true? Is Golden Gate that perfect?
Which of this techniques can give us the best result in detection of chromosomal abnormalities
Hello,
I have problems with PCR fragment sequencing (Sanger sequencing on SeqStudio). We perform sequencing reaction with BigDye™ Terminator v3.1 with subsequent purification with BigDye™ XTerminator. Sometimes sequencing reads generate spurious peaks. Please see examples attached. Has anyone experienced this kind of situation? What are the reasons and how to solve this problem?
Thank you in advance for your help.
Hello,
Please is goat genome not listed on UCSC In-Silico PCR website?
Please could someone assist on what to do if working with goat
Thank you
I am running a Nested PCR on blood DNA. Although the primers have worked successfully in previous publications, I am not getting a clear bands for sequencing. The first PCR reaction mix containing 20 µg of BSA, 5% of DMSO, 1.6 mM of MgCl2, 0.5 of each dNTP, 0.7 µM of primers, 2 U of Taq polimerase, and 200 to 500 ng of the extracted DNA. The second PCR reaction was carried containing 10 µg of BSA, 5% of DMSO, 4 mM of MgCl2, 0.7 mM of each dNTP, 0.3 µM of primers, 1.5 U of Taq polymerase, and 1 uL of the PCR1 product.
The first thermal profile consisted of 95 °C for 3 min, followed by 40 cycles at 94 °C for 40 s, 45 °C for 40 s, and 72 °C for 1 min. And final extension step of 7 min at 72 °C. The second thermal profile was 3 min at 95 °C followed by 16 cycles of a touchdown protocol at 94 °C for 40 s, decreasing the annealing temperature from 60 °C to 45 °C for 40 s (1 °C/cycle), followed by 72 °C for 1 min. Then, 30 cycles at 94 °C for 40 s, 45 °C for 40 s, and 72 °C for 1 min, with a final extension step of 7 min at 72 °C.
I have followed the published methods, but I am still not successful. Could someone provide insights to improve my reaction?
Thank you in advance
Hi all
earlier I have seen in some papers people go for DNA extraction and normal PCR using 16S rRNA primers for the identification of bacteria. However recently I have seen few papers particularly dealing with Uncultured “Candidatus” bacteria, researchers go for RNA extraction, reverse transcription RT-PCR and real-time RT-PCR ? Molecular biology experts can you please tell me …..
1. what’s the key advantage between the two ? is there any particular advantage of RT PCR for the identification of Uncultured “Candidatus” bacteria ?
2. Is it because of the possibility of “relative quantification” of the bacterium by real-time RT-PCR by targeting the 16S rRNA gene of the bacterium?
3. Is there any advantage when (RT PCR) used for uncultivable bacteria?
4. what is this Cycle threshold ? what is the significance of this in the above reaction ?
5. Also “The eukaryotic elongation factor 1 alpha from the host was used as a control of the RNA amount, and a good extraction was expected to give a Ct-value around 15 (the cycle threshold was set to 0.1). ? all results with Ct-values above 45 were considered negative !, what does it all mean?
My aim is just to identify the unculturable bacteria from tissues! Can I go for just normal PCR (16s rDNA) and sequencing the PCR products? Please
thank you
regards,
I'm having trouble obtaining clear PCR bands for DNA fragments ranging from 907 bp to 655 bp. I've tried various methods, including:
- Testing different brands of Taq DNA polymerase (Takara, NEB, Vivantis, HF Pfu DNA pol).
- Using the appropriate buffer each time.
- Isolating fresh plant DNA using the CTAB method, followed by RNase treatment, ensures the template DNA concentration is not less than 100 bp (800ng/ul - 1500 ng/ul).
- Initially, conducting gradient PCR to determine the optimal annealing temperature in the range of 51 to 60 degrees Celsius.
- Using a new vial of primers (taken from stock primers).
- Running a positive control (Actin gene, 250 bp) alongside the PCR reactions. However, no amplification was observed in the positive control, with only smear and faint bands detected in some plant samples.
- Conducting in silico testing of the primers, which indicated they should work correctly.
Please provide suggestions on how I can obtain clear PCR bands for my products.
I ran PCR using COI universal primers on DNA extracted from lice.
I added 25ul of 2x master mix, 5ul template, and 1ul each of 20uM F and R primers, with the remaining volume made up with DW to a total volume of 48ul, and ran PCR including a control group. However, no bands appeared on the gel after electrophoresis.
I then checked with a nanodrop, and all 5 PCR samples (including the control group) showed concentrations around 20000ng/ul, with A260 readings around 400, 260/230 ratios around 10-11, and 260/280 ratios around 37-47.
Where could I have gone wrong?
I would appreciate input from experienced individuals.
I am currently trying to generate expression constructs of truncated proteins for x-ray crystallography. It is my first time doing cloning. I have had success so far in PCR amplifying my inserts using primers with NdeI, Bam HI, XhoI, and EagI restristion enzyme sites. My amplified inserts are running at the correct molecular weight as confirmed by agarose gel. I always ethanol precipitate my PCR produce overnight and resuspend the DNA pellets in 10mM Tris pH 8.0 and then do a double digest of the insert using NEB's restriction enzyme cloning tool. I typically digest my inserts for ~4-6 hours and then ethanol precipitate the digestion reaction. At the same time I do a double digest my pet28 or pet 15 vector with the same restricion enzymes under similar conditions, I have checked that each enzyme has linearized my plasmid on a gel before I add the other enzyme and then combine the digestion reactions. The uncut plasmid migrates slower than the digested plasmid and the digested plasmid runs at its expected molecular weight. I also ethanol precipitate my vector after the digestion. Finally, I use T4 DNA ligase from NEB and perform the ligation reaction. I then transform 200uL of competent cells with 10uL of the ligation reaction usually. I have tested my comp cells and used a control plasmid and was able to get good transformation efficiency with only 1ng of DNA and 50uL of comp cells but since the ligation reactions tend to give little colonies I have scaled up the transformation. I mini-prep some colonies from the transformation and have done double digests for over 100 colonies now and I do not ever see a band corresponding to my insert being there. Lately I have been doing a single digest to see if I can see the plasmid molecular weight increase as a result of the insert being there, but I do not think I see an insert also. For my most recent ligation I did a 7:1 molar ration of insert to vector in a 20uL reaction with ~20ng of vector. I have also tried 50ng of vector and 20:1 10:1, 1.2:1 ratios and still i get no insert. My most recent transformation for example gave 3 colonies for my insert reaction, 0 colonies for my control of no insert +ligase, and 5 colonies for my control reaction with no insert or ligase. I haven't digested the mini-preps yet but I feel like I will not see an insert again. I would say these results have been typical for my ligations, sometimes I get ~7-27 colonies for my reaction with the insert and 0 colonies for both of my no insert controls. When I test the colonies though, I do not see an insert or shift in molecular weight indicating the insert is not in my vector. Does anyone have any suggestions how I can get a clone successfully ?
I am trying to amplify my gene for cloning. The desired PCR product is 2652 bp. The Tm for forward and reverse primers is 68.4 C and 61.3 C respectively. The annealing temp I set was 60 C. These are the results I got. How do I reduce nonspecific binding of primers? What can I do to increase primer specificity? Is the high difference in primer Tms affecting my PCR?
We run Fungal Panel using Molecular PCR Technique. We extract Nuclease Free water in the same way as we extract the sample. This eluted NFW is used as negative control on our PCR Plate for quality assurance. If we need to store this eluted sample for about a week, should we store it in the refrigerator (2-8 C) or Freezer (-20 C)?
How to identify sizes fragments of ZWF1 PCR product.
Maybe someone knows why this happens. The situation is that after PCR purification of gel products (cut one band), on the next electrophoresis, instead of one band, two bands appeared, how could this happen?
I used the Intact Genomics FastAmp® Plant Direct PCR kit and when seeding the gel with the PCR product there was a lot of DTT smell. After running the gel, partially degraded dna was observed, even in the molecular weight marker. Could it be possible that DTT diffuses into the gel and degrades the DNA?
I am trying to use the overlap extension PCR to combine two linear fragments of approximately 1200 base pairs in size. My first SOE-PCR was successful using Taq polymerase, with annealing and overlap temperatures set at 60 degrees Celsius. It had smear with my desired sharp bond. after that when I trying to repeat the process, I only obtained a smear with no specific bonds.
I amplified my fragments with taq and also pfu, but I don’t get my desired bond. I had just smear.
Does anyone have such experiment and help me, please?
Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line.
I'm using a multi-sgRNAs technique to increase my chances of a significant deletion. I isolated 4 clones of interest which share a similar trait: they all show 3 different bands after PCR amplification an electrophoresis on agarose gel. This is not so much a concern, since it was one of the expected outcome (the CRISPR/Cas9 system can create three different cutting pattern, resulting in 3 different bands). FYI, the 3 bands are all different in size from the WT band (with the top band being around 100 bp bigger than the bottom lane).
I ran again the sample on a more concentrated agarose gel (2%) with a lower voltage to get nice bands and being able to cut them. I extracted DNA from each band and re-run a PCR on each of them to increase my DNA material. For all my 4 clones, the bottom band amplify to a nice and single band corresponding in size. However, the middle and top lane display the 3 bands again, and it doesn't make sense to me. Indeed, I could understand finding the middle band in the top band sample, or the other way around. But I would have never expected finding the bottom band in the top band sample, because the top and bottom band are clearly separated and shouldn't contaminate each other.
I made a mistake by not using sterile instruments to excise my bands, which could explain in part some contamination. However, if it was this issue, I should have multiple bands in the bottoms sample, which I don't have, and I should have cross-contamination through all the sample, which is not the case. I'm pretty lost so if someone has any idea, I would take the advice with gratitude.
(I attached the gel picture from where I extracted the bands (small gel) and the re-run PCR gel whit the unexplained bands. On the gel, T= Top band; M= Middle band; B= Bottom band).
Thank you all!!
Is it possible to conduct PCR to check for resistant genes in bacteria and have no bands? All have bacteria have no bands of the resistant genes
Hi everyone,
I'm in the process of creating a zebrafish Knock-in line. In order to verifying that my integration has worked, I've created a positive control plasmid with the fragment that I would expect to have in my transgenic line.
Typically, using plasmids as a positive control for PCR reactions would yield single bands due to the purity of the plasmid. My concern is that, once I optimise my PCR using the plasmid, the PCR might not actually work when using extracted gDNA from zebrafish as the template. Hence, I was wondering if it is sensible to mix the plasmid with wild type gDNA to create an unpure template. I could then use it to optimise my PCR reaction. Does this sound feasible?
Thanks :)
I regularly have low DNA concentrations on the vetigastropod tissues I extract. I have tried fresh tissue and older/museum tissues. We use the Thermo Scientific GeneJET Genomic DNA Purification Kit.
Heating the elution buffer and using less buffer to elute does help, but concentrations are still quite low. Downstream applications are PCR and sequencing.
Super desperate and would appreciate any suggestions on how to increase the yield from extractions!!
Does anyone knows the pH acceptable range for virus transport medium (VTM) for Sars cov 2 samples? I supose that it depends if you are only testing by PCR or if you need viability for culture but does anyone has experience in this subject?
Found a studie that defends that in normal individuals with no history of reflux or eustachian tube dysfunction, the pH values range from 6.10 to 7.92 with an average pH of 7.03 (SD, 0.67) so i believe that VTM should be buffered around pH 7 (with a variation of plus or minus 1) but need to confirm that.
Thank you and be safe.
I ran the agarose gel and cut the right band, then put it to -20C, I performed PCR purification next day, but there were two bands. After two days, I ran the gel, the PCR products were almost degraded. Anyone could help me? Thank you so much.
Hi everyone,
I've been struggling doing PCR for fungi using ITS1F/ITS2R. My positive control (yeast DNA) worked well. My templates gave faint or no band. It sounds like my templates have inhibition but the 1 6S PCR worked very well for all of my templates. Also when I switched to fITS7bF/ITS4NGSR, PCR works for all of my templates as well.
I analyzed this pair of primers and found that they can formed self-dimer and primer dimer. So I've been trying many methods from increase annealing temperature, reduce primer concentration, touch down PCR, adding BSA, DMSO, increase denature time, even increase number of cycle to 40 cycles. But none of these really helps. I use Q5 hot start master mix.
Any suggestion please!
Thank you so much!
Hanh
I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009 (GRCh37/hg19)]. Is there any clue? Thanks.
Hi All,
I am trying to amplify mitochondrial 16S gene for marine snails (Calliostomatidae) and other vetigastropods, but I only get primer dimers or nothing on the gel. These primers have worked previously in my lab and in numerous other publications. The DNA concentrations are low, but they have amplified for COX1 using the Folmer universal primers.
I am using the Palumbi 16S universal primers (Forward: CGCCTGTTTATCAAAAACAT and Reverse: CCGGTCTGAACTCAGATCACGT). We bought new primers in December 2023. I resuspended them and have tried multiple aliquots. I've tried gradients 45-55 and 55-65 and a touchdown PCR starting at 59 (-1 C/cycle for 10 cycles) and final annealing at 48 for 20 cycles. I've tried the standard, ammonium, and combination 10x buffers. All reagents are from Apex (not a hot start taq), except for the dNTPs.
Our usual protocol is: 2.5 uL of 10x standard buffer, 1.25 uL of MgCl2 (50mM), 0.5 uL of dNTPs (10mM), 1 uL of both primers (10uM), 0.2 uL of taq (5 units), and 2 uL of DNA. This does work for Folmer. Denaturation at 95 C for 4 min, 35 cycles of 95C for 30 seconds, 50C for 30 seconds, and 72C for 30 seconds, and final extension at 72 for 10 min.
I'm desperate and would love to hear any suggestions/tips on how to fix this!! I also unsuccessfully tried ethanol precipitation to increase the DNA concentrations, so tips on that would be appreciated too. Thank you
Greetings to all!!
DNA is isolated from infected cotton leaf.
The image is attached. It looks kind of shearing.
What are possibilities to use it for PCR?
I am looking for help to optimize a nested PCR from Long Range (LR) PCR (DNA as template). The LR PCR product looks spesific on agarose gel. We have tried various dilutions of this product as template, but keep getting a couple of unspesific bands on the gel in addition to the expected product (the unspesific bands are a little larger in size than the expected product). When we add genomic DNA instead of the diluted LR PCR product, using the same polymerase and conditions, we get clean product of the correct size. What could be the cause of the unspesific bands? Is it necessary to clean up the LR PCR product before using it as template for nested PCR when we dilute it (1:50, 1:100, 1:1000)?
Hello all, I have a query in resolving close products in agarose gel electrophoresis: I have three different expected products in my samples: 460bp, 480bp (only in mutation), 323bp, and I run them in a 3.2% TBE agarose gel, thickness 0.75cm, running conditions: 75V, at 4degreeC, for rough 8hrs with paused interruptions for detection every 2 hrs. What I see is that I have a definite signal at 323bp and 460 bp, then between 500-600 bps I have various other products (picture here after 8hr 10mins). I had cut the band, eluted the DNA and Sanger sequenced the products, turns out the band at 500bp is the same as 461bps and the band at 550bps is the same as the 323bps. The band at 460bps of the mutants, is a mixed signal in the middle of the Sanger sequence, where I could see that it has the sequence of the 323bps and the 480bps with the main 460bp sequence.
With the a second PCR of same settings and cdna, I run the sample with 3.2% agarose in TBE, reduced the thickness to 0.5cm this time, run it for 2 hrs in 150V, then further at 25V for 12hrs at room temperature. Here I do not see, multiple products between 500-600bps but one single product around 800bps. Can PCR products heteromerise when they run through a high % agarose gel?
I would like to resolve the products, but still avoid the poor resolution of some portion of the products, in the agarose gel. I am using the biozym LE agarose. any suggestions to improve for this experiment please?
I performed RT-PCR to validate my differentially expressed microRNAs. But I didn't get any accurate results. What is the reason? I also performed standard PCR (with a gradient temperature) to select the best temperature and got bands at almost all temperatures. My reference gene (U6 SnRNA) worked well in RT-PCR, but miRNA-specific primers didn't show any results (amplification has occurred).
Please help me to find the correct reason.
Hi everyone, I'm doing PCR for mycoplasma detection I'm using the primers GPO-3 and MGSO; the denaturation, annealing, and elongation temperatures and times were 95oC for 2min, 95oC for 30s, 57oC for 45s, 72oC for 1min, 72oC for 7min, for 40 cycles. The results were analized by gel electrophoresis using 1.5% agarose.
A band in 270pb is a positive result, but in some samples a band is amplified in 200pb. I was suggested that this band could be interpreted as a positive result for a different mycoplasma genus.
Polymerase Chain Reaction (PCR) testing is a molecular biology technique used to amplify and analyze DNA or RNA samples. So, To perform PCR testing, which list of laboratory apparatus and equipment is required?
I am trying to check the homozygous mutant for Arabidopsis (seeds ordered from ABRC). I have done genomic DNA extraction, using Edward's method and checked the it in agarose, the genomic DNA is there. And also I got quite a good concentration of about 1ug/ul. I designed primers using SIGnal primers design against the salk ids, but my PCR is not working. I have tried different temperatures and polymerases.i have kept the 1st denaturation time about 10 min, and checked the primers, its interacting fine with the genomic DNA using clustal omega. where am I doing wrong?
Hello everyone,
I've been trying to clone a bacterial protein from S. aureus into E. coli with pQE30 vector.
After ligation and transformation (with Xl1Blue), I screened my colonies (more than 30) and ended up with just two positive clones. However, one of these clones seems to have both the empty vector and the ligated product (see picture).
Is it possible that this clone during transformatiom did uptake both a re-ligated vector and the vector+insert? I'm pretty sure that I did not pick up two colonies instead of just one.
If they have both of them, can I continue with sequencing to check if my insert is not mutated? If I send to sequence a mixed sample with both the empty vector and vector+insert will it work? And if my insert turns out to be okay and I go on with transformation of BL21 cells and purification will I be able to obtain my protein even if I have an empty vector?
Anyway, I'll try to do another ligation and transformation to obtain more positive clones hopefully.
Thank you in advance!
The Quantstudio 3 qPCR machine works really well with low-ROX SYBR premix PCR, I just concern about whether it can work in high-ROX premix or no-ROX premix? In the software, the reference dye can be chose as ROX or none, etc, but not having options like low-ROX or high-ROX?
Having problems with dimers and an answer from Paul Rutland for another question made me think that the fact that I store my PCR mix in the fridge might be the problem. I must add that in this mix I add both primers, so maybe dimers are being formed prior to the reaction during storage. Does this make sense?
Previously I have cloned estA gene in pET28b with restriction sites EcoRI and BamHI and stored it in -80˚C. I also proceeded with site directed mutagenesis (SDM) after confirmation of the cloning via PCR gene amplification. However, I didn't get positive result post SDM. Now, as I'm trying to repeat the experiment, I'm unable to exact the plasmid from the previously cloned bacteria and stored as glycerol stock. The bacteria shows antibiotic resistance but when I try to extract plasmid and confirm through gel electrophoresis, I'm not getting any band. Please can anyone guide me and help me troubleshoot the problem.
I am working with an allergen and i am working using PCR, the result that offers the kit is copies DNA, although i need to give a result in mg/kg. Is any possible way?
Thank you in advance,
Kiriakos
I have ran a gel to determine DNA products with the following base pairs, 745
590, 317 and 825. However, I got bands just below the ladder, my negative control came out negative and I do not know what conditions to change to address this.
Hi all. I have some primer pairs which always produce those horrible primer dimer bright smear! Increasing annealing temperature does not solve the problem. Any suggestiopn for a PCR enhancer or another strategy? So far I have used DTT and DMSO and amplification quality still poor! Thanks
Hello,
I am interested in performing genomic DNA extractions and subsequent PCR analysis on some human cells (HEK293T). However, I am thinking of using a "colony PCR", i.e., by taking a number of cells and putting them into the PCR conditions and hoping that the initial denaturation temperature at 95℃ is enough to lyse the cells and release the genomic DNA.
Is this possible to be done? Has anyone attempted this, and if they have succeeded, how many cells are required and what are the parameters of the PCR conditions?
Thank you very much in advance!
We recently got a new cell line in the laboratory but are having difficultly amplifying the resulting gDNA in any PCRs. We use the standard Bioline isolate II genomic extraction kit which we haven't had any trouble with for other cell lines. When DNA extracted from this cell line we get a workable yield (25ng/ul-180ng/ul depending on # cells used) and the 260/280 + 260/230 are always correct.
We have tried amplifying this DNA in >6 different primer sets which are all well optimised and consistently work for other cell lines yet it will not work for this. For reference we have completed this gDNA extraction with fresh cells on 5 separate occasions alongside other samples to rule out user error and all other samples have worked except for this one.
We have tried:
- Reprecipitating the DNA using a standard salt-ethanol protocol
- Using primer sets for a different gene
- Reducing DNA to 5ng, 10ng and 20ng (we use 50ng for standard 25ul reaction using ThermoFisher Phusion II enzyme) to dilute any PCR inhibitor
- Increasing DNA to 100ng, 200ng
- Reamplifying template (this gave non-specific bands)
- Washing cell pellet in PBS before extraction
- Extra washes during extraction process
It appears there is some cell-specific contaminant preventing PCR amplification.
If anyone has seen this before or knows of any troubleshooting recommendations that would be great!
What would be the usefulness of quantifying cDNA before conducting a PCR, and how could it influence the effectiveness and reproducibility of the obtained results?
I designed a primer for gene sequence(1480 bp) and when carried PCR, the product was 150 bp, what is the problem? and how to obtain the correct fragment?
Hi.
I’ve been unsuccessfully trying to isolate DNA from neurons extracted from adult mouse brains for further downstream analysis.
First I’ve tried sorting neuronal nuclei (Approx. 105 NeuN+ nuclei/sample) (protocol by Nott et al Nat Protoc 2021), followed by DNA isolation and qPCR analysis. However, my PTHrP levels were always undetectable.
Then I moved to commercial kits, and bought the adult neuron isolation kit from Miltenyi. As I read, one would expect approx. 105 isolated neurons per adult brain. I did the whole trinity from Miltenyi: 1. Adult Brain Dissociation Kit, 2. Myelin Removal Beads II, 3. Adult Neuron Isolation Kit. However, again after following the protocols, and immediately isolating the DNA (Nucleospin tissue from MN) I did qPCR (sybr green) and again I did not detect PTHrP in my samples!
I’ve preformed DNA isolation for high yield and concentration in a final 60ul elution volume. Following DNA isolation, the samples were stored at +4C, and the qPCR was done the next morning.
In my control samples from other tissue, I can detect PTHrP which means the qPCR protocol and primers are working fine.
Am I doing something wrong with the DNA isolation and therefore losing my DNA? Is there an alternative method to get clean neuron populations for DNA isolation?
I would be grateful for any help!
Best,
hey I really need an urgent help
I'm so confused with the primer sequence of 1492R.
some journals said that 1492R is GGTTACCTTGTTACGACTT (and I use this as my PCR)
but the research company that will help me sequence my bacteria said that 1492R is TACGGYTACCTTGTTACGACTT
I need this answer as soon as possible because I have to send my PCR product to sequence service, thank you
So, here is what I am dealing with:
The Tm of the primers is 55 for the forward one and 56 for the reverse one. In -silico PCR produces 750 BP band, but in reality I get 3 bands. The third one looks like a primer-dimer.
Clearly the primers could be decreased and I used primers diluted to 10 uM each and I 1:3 dilution from it, which didn't give me any product. I tried 1:2 dilution today: this decreased band intensity and didn't get rid of the extra/lower band.
The question is where do I go from here?
-Gradually raise the annealing temperature?
-Will DMSO help?
-Increasing DNA concentration, while decreasing primer concentration?
Does Tm really matter? Should I just try different annealing temperatures?
Thanks in advance !
I'd like to detect the presence of different species in a DNA extract using qPCR. Are there specific targets already listed for each species (animals, yeasts)?
Thanks,
I am amplifying target sequence 450 bp. I get single sharp band in the control and faint in sample with another sharp nonspecific product. why?
I need to get one single band from my sample to sequence the target . what should I change?
I changed annealing and DNA concentration, time of each cycle and used different PCR master mixes.
I just found the Platinum SuperFi II DNA Polymerase, which should simplify PCR protocol as it allows uniform annealing temperature of 60°C, but it should also have very high fidelity; >300× higher than Taq Pol, that should be even more than Q5, reported by NEB to have 280× higher fidelity than Taq Pol.
The SuperFi II DNA Polymerase should even allow amplification up to 40 kbp, while Q5 only up to 20 kbp.
This looks like we have new Queen in the HighFidelity DNA Pol area, don't we? Does somebody have experience with this enzyme?
Hey everyone,
my question is maybe strange at first glance, but simple: is the rapid 16S kit's only real advantage the significantly larger 16S data amount generation? Shouldn't I be perfectly able to collect necessary strain-level diversity 16S data on the data analysis level from a total nanopore metagenome, without the PCR bias, given enough sample input? If the above thinking is correct, would you consider triple-digit ng input (below 1ug) sufficient, at least for key players of a mixed microbial community?
Just trying to understand if I really need the 16S barcoding kit since I have the native one (which I will use for total metagenome anyway)
Cheers
A
So let say I have circular plasmid named "PDR111". I did PCR with KOD ONE MIX KIT and the product is linear DNA. Then, I did self circularization of linear DNA with T4 DNA Ligase protocol (Thermo Scientific #EL0014). I did everything right as the protocol said, But my transformation keep fail. Here's how my electrophoresis looks. My Plasmid size is 11871 kb. Pls guide me
I successfully amplified fungal ITS from soil samples, however after running the purified PCR products in an agarose gel they are barely visible and don't look like defined bands but rather clouds. The purification was done with the Monarch PCR and DNA Cleanup Kit. Why could this be happening?
Hi, I am using VASA-seq for RNA sequencing. The last two steps of the protocol are cDNA synthesis (via reverse transcription) and PCR. I had been using Superscript III for cDNA synthesis and was getting a lower PCR yield. Then I switched to Maxima H Minus Reverse Transcriptase. The PCR yield increased dramatically, but I am getting this weird around 1200 bp long fragments (see the attached figure). My expected peak is around 300 bp. I have attached a figure of the fragment size distribution of the PCR DNA (analyzed on fragment analyzer).
#fragment_analyzer #PCR #VASA_seq #Maxima H Minus Reverse Transcriptase #SuperscriptIII
Hello! I've encountered some challenges with Traditional PCR.
I've successfully conducted RNA extraction, quantification, and integrity checks, all yielding positive results. (first image its from the integrity of the RNA)
Moving forward, I proceeded with RT-PCR, followed by PCR endpoint analysis using Actin primers. My experimental design involves four treatments, including Ctrl, Resveratrol, LPS, Resveratrol+LPS, with two samples for each treatment.
However, I've encountered an issue where only the controls are being amplified during the PCR endpoint, despite using the same mix for all samples in both the RT-PCR and Traditional PCR for Actin. I'm puzzled and unable to pinpoint the source of this discrepancy. Any insights or suggestions would be greatly appreciated.
The second image its the results of the PCR.
I ran a PCR reaction and it gave good result during the trial run. However, once I ran the same PCR reaction on all of the other samples, there are smears and appearance of non-specific bands. I'm not sure on what went wrong. Hopefully, I could get some insights to fix this issue. Thank you in advance!
Dear virologists; What is the PCR technique used in virology to detect viral nucleic acids? The steps involved.
I'd also like to know, since some viruses have a single strand of DNA and RNA, how does amplification work in this case?
Kind regards
I am currently cloning a gene of interest (460bp). I amplified my gene of interest using two polymerase 1) NEB Q5 polymerase enzyme 2) Taq polymerase. The forward primer has XHOI restriction site, and the reverse primer has NOTI restriction site. After amplification of my insert, I PCR purified the product and proceeded further to double digestion. For double digestion I used XHO1 and NOT1. After double digestion the product generated from Taq polymerase yielded digested product whereas double digestion of product yielded from Q5 polymerase seems like uncut. What will be the possible problem here. How to trouble shoot this?
Note: I have performed both sequential digestion and double digestion for Q5 polymerase generated amplicons.
Thanks, in advance.
I have been preparing NGS Library, where the samples input volumes, conditions followed and the PCR Cycles are same but still the concentration obtained was uneven and the fragments size where also differ from sample to sample. What could be the possible reason for this uneven results.
I had done PCR using GoTaq q PCR mastermix (Promega) for detection Hepatitis B virus cccDNA. For that purpose, which Ct value I will consider as detected or undetected?
We would like to purchase around 10 thousand DNA oligos in a 96 well format (25 nmol). The cost per base is coming to around Rs 14-15. We wonder if there is any economical option available in the market.
Thank you
If so, how long after it expired? It has been stored in -20 degrees and will expire in one month. I have ordered more than I could use for the time being. Thanks.
I am trying to insert a His tag in my vector backbone that is of pCDNA.However I am getting wild type colonies of the vector after sequencing. I have used 50 ng of template for mutation PCR and even performed DpN1 digestion for 3 hrs. What might be the reason for getting wild type colonies even after performing DpN1 digestion?
I have designed 2 primers
Now I need to set up the PCR protocol.
First: I need to know how much of each primer, H20 and GoTaq® G2 Hot Start Taq Polymerase to put in the mix. We usually put a total of 14 ul in our PCR = 12 ul mix and 2 ul DNA.
Second: I need to know the temperatures and the durations and number of cycles needed to run the PCR in the thermocycler. Is there a rule to know that?
Please help .. Thank you
Hello everyone
I am working on amplicons for species delimitation on corals.
My supervisor want me to make it through a 4 primers PCR on 4 loci (CR, ITS, ORF and ATPSbeta)
I have been trying for mounth to make this method works but it seems simply impossible
so basicly what i am doing is as follow
my MM is composed of
12.5 µl of green taq
1 µl of inner primer (F and R)
1 µl of barcodes (F and R)
8 µl of water
1.3 µl of DMSO
the cycle is as the screenshot i took (see pictures)
The PCR itself doesn't work, it oly work when i am diluting the barcodes. The more i dilute the more the PCR work (see image barcodes dillution). However if i dilute the barcodes, the PCR product isn't barcoded and it's impossible to retrieve any information from the sequencing.
I have been trying everything to make it work but i feel like there is no solution. Has anyone any advice to make this PCR work with barcoding ?.
I have also tried to separate the inner primer cycle (the 5 first cycle) from the barcodes cycle (the 30 last cycle), it makes the PCR work better but not that much.
i feel like the inner primer also amplificate the DNA in the last 30 cycle and that the barcodes are just amplificating the inner primer and doing dimer. I also tried to dilute the inner primer but then it doesn't work at all
While I was amplifying a certain gene from chromosomal DNA for my Gibson Cloning, I noticed after sequencing that there is one extra A on the middle of my gene of interest sequence. In the original sequence there are six A (AAAAAA) but when I cloned on the plasmid, the whole plasmid sequencing showed seven A (AAAAAAA) making a frame shift mutation. I used Hight Fidelity Phusion DNA polymerase for PCR amplification. Do you recommend any other polymerase?
Thank you so much for your suggestion.
Hi guys, I am currently working on qRT-PCR. However, the amount cDNA I got from RT reaction is too little to assess all the targets.
I saw some papers and websites mentioning amplifying cDNA with PCR, I wonder if it is a good thing to do, or if it is better to redo all from the very beginning (extract RNA from tissue).
Many Thanks!
Will my PCR product be viable for Sanger Sequencing? I (a dumb undergrad) left my PCR product in the fridge because I was planning on finishing preparing the samples that week to send out but then my coursework got in the way of that project, and I forgot about the samples in the fridge. Long story short, I left my PCR product in the fridge for about a month, and I still need to send those samples out. My question is, should I send them out as-is, or should I re-PCR them using the PCR product as my sample, or worse, take some of the original (limited) DNA from the extraction for a new PCR? I don't want to waste any of my lab's resources either by sending samples that I should just trash out for sequencing, or by doing an unnecessary PCR/ Gel. Thank you in advance.
I would like to ask about the possibility of using primers <12-15 bases> to amplify very short fragments <35-45 bases>. This is probably a terrible idea and I want to see what people have been doing. Dimer formation, low tm and ta, are a few things that could make this not work.
Let's assume synthesizing the fragment isn't an option as I want to introduce certain changes via the primers for other downstream applications.
Thanks
Hey all
I added 10uM of primer instead of 0.5uM in a 10uL PCR reaction. What are the expected results? Will the amplification of the desired product happen by any chance?
What should be the temperature for PCR machine lid during ligation overnight at 16c? Will the usual lid temperature at 105c affect the ligase performance?
I have raw qPCR data. 2 samples "1 control and 1 with gene knock out". I made a serial dilution of each sample and performed a qPCR using 2 reference genes and 3 genes of interest. Now I have the raw data “the CT and average CT of each sample. I want to present the data as a chart. What exactly do I put in the chart. The delta delta CT? Or the 2^-delta delta CT? Or something else?
and do I put all the dilutions in the chart? or just the undiluted original sample? or calculate an average or a geomean of the sample and the diluted samples?
Another question. When I have more than one house keeping gene or reference gene, can I take the geomean of the average CT of both genes to calculate the delta CT?
I frequently experience that it does not work while preparing large volumes like 50 μl of PCR mixture, though the same ratios of chemicals operate when I make little amounts (15 μl) of PCR chemicals. What's the probable cause of this issue?
I am working HIV. My RNA concentration is 57-65 ng/ul. AFTER cDNA preparation I did not get any PCR result. Only dimer are on the gel. Highly Visible dimers are on gel.
I'm optimizing an assay which has a target PCR product with size of ~1.1 kb (based on primer in-silico analysis). However, I've been observing distinct PCR bands larger than the expected size. The PCR bands observed has a size of 2.0kb > x > 1.5kb.
We'll sequence the PCR products anytime soon but I want to know why this happens. Thanks in advance!
Hi ALL,
I am using a pair of primers to amplify a region in my gene of interest from cDNA samples. The cDNA samples are extracted from tissues of mouse of different ages. The gene is known to have decerased expression level when mouse ages. However, I did not see any change of the RT-PCR amplicon band intensities on agarose gel, indicating no change for the transcript level. I did not saturate the PCR products as I tried different cycle numbers (from 23 to 30 cycles). What could be the possible reasons? Should I design new primers targeting a different regions in my gene? Thank you for the help!
I faced with a problem, and I think you can help me regarding this issue.
I have sent one of my PCR poducts (ITS1-ITS4) to a company in order to sequence it. Indeed, I sent them various PCR products before and the results are always very nice. However, The result of this latter product is also without any noise but it is only 157 bp long. Do you have any idea why this sequence is very short in size?
Statement 1: we got one sample to have HBeAg ELISA and HBV PCR both Positive, indicating active replication present in the HBV virus.
Statement 2: we got one sample to have HBeAg ELISA negative, but HBV PCR positive, is this possible?
Statement 3: we got one sample to have HBeAg ELISA positive, but HBV PCR negative, is this possible?
Does anybody explain this variation and possibility? Can i get any reference?
Thanks in advance to all.
Hi to all,
Does anybody suggest Pan-HCV and Pan-HBV for conventional and real-time PCR-positive control purposes? Due to viral instability, we are unable to use the known positive samples for cross-checking purposes. we need as follows:
1. Any commercial kit is available?
2. Does anybody suggest to availability of a reference article that we have to follow and buy (synthesis by commercial order)?
Thanks in advance.
Hi!
We are sequencing exon 5-6 from the BEST1 gene, we have multiple patients afected, with the explaining mutation, but in this cohort we found that in our forward sequences we can identify positively the mutation, but not in the reverse sequence.
Yes, we sequenced them multiple times, with alternative PCR products, primers and looked for pseudogenes regions, but no answer to this phenomena is found.
somebody has some insights?
I have read in several articles that it could be an enhancer of PCR efficiency. Is this the case? How and why?
Is It more cost effective to analyze multiple genes using TaqMan versus traditional qRT-PCR? What other main advantages and disadvantages exist for each method?
I’m trying to analyze several genes specific to bone cells. I’m interested in specifically looking at: OCN, ALP, RUNX2, Sox9, TRAP, CatK, VEGF, CD34, and COL1A.
In the SSR method, I used the same pair of primers (forward and reverse) in two different individuals, but I observed different band patterns in PCR.