Science method
Primer - Science method
Explore the latest questions and answers in Primer, and find Primer experts.
Questions related to Primer
Hello,
I am making some plasmid constructs via Inverse PCR and T4 enzyme ligation.
I started with a plasmid that housed nucleotide sequences for two fused proteins. My goal was to cut out the nucleotide sequence for just one of the proteins.
For my Inverse PCR primers, I designed the forward primer to be at the beginning of the desired protein. The primer was 35 nucleotide long
I designed the reverse primer to be 34 nucleotides long. It included the vector sequence just before the undesired protein.
After amplification with inverse PCR, I ran the sample on the gel and if the band was correct, I purified the DNA from the gel.
I then added I 2ul ligase buffer and 1ul T4 PNK and incubated it at 37C for 30 minutes. Then I let it sit at room temp for 5 minutes before I added 1 ul ligase.
Then I left it at room temperature for a few hours and before I stored it in 4C overnight.
I have done this process before and it has worked for me. However, I keep running into an issue where I continually have a one nucleotide deletion right at the site of ligation.
For example,
If I want this sequence: ATGCAC
I will get this sequence instead: ATCAC
That "G" is right at the junction. For some reason, it continually gets deleted during ligation.
I was wondering if anyone has any suggestions on how to prevent this from happening? Maybe there is something wrong with the procedure that I am using to ligate?
I am doing my undergrad thesis that requires me to do PCR-RFLP analysis on DNA that I extracted from some blood samples. Initially, I was using the Qiagen mastermix for the optimization of my entire process using just 6 samples out of 100 samples. I successfully completed my optimization step, and got my desired results for those 6 samples. Once I have the measurements of the entire process i.e the amount of mastermix, forward priner, reverse primer, DNA template, and nuclease-free water along with the optimum annealing temperature for my selected primer, I proceeded on to doing the exact same thing on the remaining 96 samples serially. But I started encountering an unexpected error. For some reason, I started getting a faint band in my negative control(which only has nuclease-free water and no DNA template). At first I thought any of the reagents were contaminated, so I conducted a series of PCR reactions where in one I would use a freshly new mastermix, another time a fresh made working solution of primers and also an intact nuclease free water. In every PCR, I am getting a band in my negative control. Today I also tried using a mastermix of an entirely different company i.e. Takara Bio, but got the same results. I am just frustrated at this point. Can anyone help me figure out what is happening? How can I troubleshoot this and complete my thesis!
how can i have one peak in melting curve of primer in Real-time PCR?
I synthesized cDNA from my RNA sample that prepared with Trizol. I got the ratio 260/280 in about 1,6. When I was running the PCR to check the primer that I have designed before, I got the smear on my electrophoresis gel which are not as I expected, because the product seems bigger than it should be. I designed primer with product length around 150-200, but the bands appeared in about >300. And for my housekeeping gene, 18S, there were bands in my RT+, RT-, and -ve. So I decided to do DNAse treatment to get rid off the DNA contamination.
But, when I repeat the PCR protocol again, I only got the band for 18S primer on my RT+,RT-, and -ve, while the other primer seemed not work.
What should I do now? Need help since I am new in this field.
Dear experts,
I am planning to generate a large numbers of Illumina libraries in an ongoing project. These will be amplified via a single PCR step, in which the indexed adapters are added to the PCR primers. Can I just order such primers as normal PCR primers including the indices or will their quality be insufficient for NGS application (regarding index hopping etc.)? The commercially available kits for indexing are very expensive.
I would be very grateful if anyone who did this already could share some experiences. Kind regards and thank you in advance, Matthias
PS:
In case more information is required, this is the PCR protocol which I am trying to run:
I designed primer to clone the target gene with RBS, his tag.
I want to confirm below:
1. if Is it okay that extra sequence longer than target gene part?? Targeted gene part is 18bp long
But including rbs histtag part is about 41bp
I concerned if it's is too big size
2. I designed as RBS located after his tag sequence
But should I put RBS first and. His tag sequence later????
Please kindly give me advice
Thank you in advance!!!
my gene of interest size is about 4kb. I used hi fidelity taq pol as well as Q5 from NEB but still its happening. my forward primer composed of a 4 adenosine then restriction site followed by 6x his tag then enterokinase site and forward primer of amplicon.(63 bases) and reverse is normal,4 adenosine then restriction site followed by reverse primer of amplicon( 30bases). i changed all the reagents to improve pcr but same result follows. what should I do now?
would like to work on microRNA to detect colorectal cancer. I will use the type of microRNA type micRNA124,micro143 how I can make primer design for it and how I can choose the primer ?
Hi!
I am to site-specifically label dsDNA parts using PCR with fluorescently labeled primers. For my objective it would be optimal if the primers could carry the fluorophore as close to their 3'-end as possible, preferably exactly at the 3'-end. I am worried however that perhaps this would prevent the polymerase's ability to elongate during PCR.
I have seen others label the primers as close as 1 position upstream of the 3'-end e.g. in:
Nazarenko I, Lowe B, Darfler M, Ikonomi P, Schuster D, Rashtchian A. Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Res. 2002 May 1;30(9):e37. doi: 10.1093/nar/30.9.e37. PMID: 11972352; PMCID: PMC113860.
Can DNA polymerase elongate if the 3'-end of the primer is modified with a fluorescent tag?
Thankful for any input!
All the best,
Niklas Eckert Elfving
Uppsala University
My fellow Academic colleagues!
I together with my lab mates have a PCR-related issues that we hope that some(one) of you might have encountered and hopefully solved.
In “short”, our initial PCR (MiniAmp Plus thermocycler) and electrophoresis protocol works like a charm – the latter somewhat modified. We obtain weak to strong band that yielding concentrations of 9 to 20 ng/µl following clean-up using the QIAGEN QIAquick PCR (& Gel) purification/Cleanup Kit (with an acceptable A260/A280 ratio). We obtain rarely, but from time to time, a positive electrophoresis confirmation. But as we are using the same protocol for the confirmation, as for our initial PCR, we should have no issue confirming our results (one band per week).
Usually, when we try to confirm our cut-out electrophoresis bands, running a PCR on our cDNA, something fails. We utilize the same primers and protocol, as for the initial PCR, but nothing shows up in our gel, our at best a streak. We’ve tried renewing our primer mix(s), new isopropanol, new buffers, using both RNAse-free water and the included buffer, modifying temperatures (thermocycler), number of cycles, and using the original non-modified protocol. But nothing results in an electrophoresis band when we try to confirm our initial band.
Thank you for your insights and help!
// Eriksson et al.
I want to do PCR amplification with my full-length gene and the addition of P2A fragment at the end of my gene. However after doing PCR, I run gel electrophoresis for analysis. But it doesn't include the band for my gene. I run the same template DNA with other primers for smaller fragment, and it has the band. I tried to redesign my primers for full-length fragment, but it still don't have the band for my gene. Can anyone help me? Thank you
Hello.
I have a problem with our in-house designed rt PCR for Cutibacterium acnes. Primers and probes were designed as part of mPCR. While testing each set of primers (monoplex) for LOD we are constantly getting false positive negative control. We repeated reaction many times. We change all reagents for new (to exclude contaminated reagents) and still the negative control in late positive in around 38 Ct. We tested negative control with 16S PCR and was negative. I was thinking to set a Cutoff/threshold? Does anybody has experiance with setting it? Thank you.
Anja
The common Tm without Restriction site is 61 degrees and the Tm with Restriction site is 71 degrees. The reaction conditions i followed is 95 degrees 3 mins, 95 degrees 30 secs, Tm (60-68) degrees (perfomed both gradient (35 cycles) and touch down (8-10 cycles each , extension 72 degrees (1.5 min, size 1500 bp), final extension 72 degrees 5 mins. I have used Mgcl2 as well. All the PCR components work well as actin shows the band in the gel, but target gene does not amplify, primer dimer is visible (i had to select that set of primers to cover desired length). Kindly guide
when I insert my primers in primer blast site and push the button "get primers" I just reach different errors and I don't know what the problem is!
A need to analyse specific sequences gathered from genbank in order to analyse primers matching/designing. I have used Sequencher (gene codes) in the past and I loved it. Yet prices are now prohibitive. Any suggestions?
Hi,
I need to create individual rarefaction curves for my microbial ecology data (86 samples with several thousand OTUs each). How do I do this in Primer 7 (or Excel)?
Thanks,
Catharina
I recently designed the qrtpcr primers from the 3'utr of the plant's genomic DNA keeping in mind that the annealing temperature should be 60 degree. Once I received the primers first to optimise their annealing temperature I set a gradient PCR on the genomic DNA itself (the concentration used was 25ng/ul) from temperatures ranging from 53-60 and 49-59 but I didn't see any band in the earlier temperature range but I did see some specific+ non specific band atleast for one amplicon in the later temperature range. Now how is this possible if the temperature that I chose while designing the primers using different softwares is sooo far fetch from the temperature where I am seeing the band. And why is it so? Still I am not sure whether the band that I feel is specific or non specific?? Please suggest me what do I need to change.
Note: I already did BLAST as well while designing the primers
I am running a Nested PCR on blood DNA. Although the primers have worked successfully in previous publications, I am not getting a clear bands for sequencing. The first PCR reaction mix containing 20 µg of BSA, 5% of DMSO, 1.6 mM of MgCl2, 0.5 of each dNTP, 0.7 µM of primers, 2 U of Taq polimerase, and 200 to 500 ng of the extracted DNA. The second PCR reaction was carried containing 10 µg of BSA, 5% of DMSO, 4 mM of MgCl2, 0.7 mM of each dNTP, 0.3 µM of primers, 1.5 U of Taq polymerase, and 1 uL of the PCR1 product.
The first thermal profile consisted of 95 °C for 3 min, followed by 40 cycles at 94 °C for 40 s, 45 °C for 40 s, and 72 °C for 1 min. And final extension step of 7 min at 72 °C. The second thermal profile was 3 min at 95 °C followed by 16 cycles of a touchdown protocol at 94 °C for 40 s, decreasing the annealing temperature from 60 °C to 45 °C for 40 s (1 °C/cycle), followed by 72 °C for 1 min. Then, 30 cycles at 94 °C for 40 s, 45 °C for 40 s, and 72 °C for 1 min, with a final extension step of 7 min at 72 °C.
I have followed the published methods, but I am still not successful. Could someone provide insights to improve my reaction?
Thank you in advance
Hello everybody.
For my project i need to identify the APOe isoforms present on my patient derived lines.
My idea was to extract DNA, amplify with PCR and send it for Sanger sequencing - basically how routinely done in multiple papers.
So far i used multiple primers (both designed by me or found in publications) that either target the whole area of interest where the mutation is (112 and 158) or singularly each of part - with zero results. In some cases the primers were working properly (showing a perfect single band on gel), but then the sanger sequinning came back extremely dirty and unusable.
I also tried multiple mixes of primers, PCR protocols, TAQs ecc, but all of them without any success or with same Sanger messy results.
Just as an additional information, the area of interest is extremely GC rich (70-80%).
Can someone advise or share a good set of primers that are tested and a related PCR protocol? if this won't work, we would proceed with exons sequencing, but this is time consuming and expensive.
Thanks a lot
Francesco
I am working on Cape fur seals and designed a primer to amplify a region in the hypervariable control region 1. This primer produces the correct sized band when amplifying with PCR. However, although the forward reaction sequences well the reverse reaction constantly fails. I have tried different samples, primer concentrations and annealing temperatures. What could be the cause of this?
F: ATAATAATTACTTTGGTCTTGTAAACC
R: TATCTAGTTCTGTTTTCGGG
I can't find the DNA band of degenerate primer, I've done gradient PCR, DNA concentration variation, and touchdown PCR. The DNA I used is plant DNA. There is no problem with my DNA, because I have tried it with other primers as a positive control. how do I get a DNA band?
Should I make internal control markers for the degenerated primers? How to do it?
I'm having trouble obtaining clear PCR bands for DNA fragments ranging from 907 bp to 655 bp. I've tried various methods, including:
- Testing different brands of Taq DNA polymerase (Takara, NEB, Vivantis, HF Pfu DNA pol).
- Using the appropriate buffer each time.
- Isolating fresh plant DNA using the CTAB method, followed by RNase treatment, ensures the template DNA concentration is not less than 100 bp (800ng/ul - 1500 ng/ul).
- Initially, conducting gradient PCR to determine the optimal annealing temperature in the range of 51 to 60 degrees Celsius.
- Using a new vial of primers (taken from stock primers).
- Running a positive control (Actin gene, 250 bp) alongside the PCR reactions. However, no amplification was observed in the positive control, with only smear and faint bands detected in some plant samples.
- Conducting in silico testing of the primers, which indicated they should work correctly.
Please provide suggestions on how I can obtain clear PCR bands for my products.
presently I'm doing one study on ASSOCIATION OF COMT GENE VARIANT WITH ALCOHOL USE DISORDER.
the methodology consists of conventional pcr with comt primers and rflp with NIA III rest enzyme.
after conventional pcr I have got the 231bp gene of interest and usually after rflp if no mutation in the comt gene then there is no cut to the gene but if mutation is there, then 231bp gene is cut to 103bp,70,bp and 58bp.
but after following the NEB res enz protocol, there is neither non mutation band nor the mutation band is seen.
i have attached the protocols and gel pictures
For my thesis on the same HPV L1 region sequencing for detecting genotypes , I have used My09/11 & GP5+/6+ primers for amplification on Nested PCR, but I couldn't find sequences other than 16, while same sample showed positive for 16, 18 & other High Risk genotypes on Real Time PCR (Geneproof). Does Nested PCR with My09/11 & GP 5+/6+ can not detect other genotypes other than 16?
Dear Team Fungi,
We would like to identify root fungi from Vitis vinefera via metabarcoding. The methodology is established, we have had good results with other root samples using the isolation kit 'innuPREP DNA/RNA MiniKit' and the standard primers gITS7ngs/ITS4ngs with 49 °C annealing temperature. Unfortunately, we do not get any bands from Vitis roots, no matter what we try (e.g, adding BSA or a temperature gradient). Does anyone have any ideas on how to modify the DNA isolation or PCR to eliminate the potential interfering substance in Vitis roots? There must be something in there that interferes with the PCR...
With desperate regards
Kai
I want to copy a target gene from cDNA into a plasmid. The primers were designed according to the CDS sequence from NCBI. But when I performed PCR reactions I could not get any target bands. So the CDS sequence was synthesized into my plasmid vector. When used the plasmid as template and the above primers to run PCR, target bands were quite clear which means the primers can work. I know the gene copy number in plasmid must be much higher than in cDNA. So I increased the amount of cDNA template and cycle numbers (from 35 to 45 cycles), no target bands showed. Could anyone tell me what the problem might be. Is that possible that the CDS sequence in my cells has changed? If yes, is there any other ways to get the CDS sequence except artificial synthesis.
I am trying to amplify my gene for cloning. The desired PCR product is 2652 bp. The Tm for forward and reverse primers is 68.4 C and 61.3 C respectively. The annealing temp I set was 60 C. These are the results I got. How do I reduce nonspecific binding of primers? What can I do to increase primer specificity? Is the high difference in primer Tms affecting my PCR?
That gene has four transcripts. To experiment with gene expression, I have designed a qPCR primer from NCBI. But it gives me primer pairs, of which forward primer binds to the exon-exon junction but reverse primer binds to UTR. So, will there be a problem getting the qPCR product?
That gene has four transcripts. To experiment with gene expression, I have designed a qPCR primer from NCBI. But it gives me primer pairs, of which forward primer binds to the exon-exon junction but reverse primer binds to UTR. So, will there be a problem getting the qPCR product?
NdeI restriction site was added in forward primer and HindIII was added in reverse primer size of band is looking near 500 bp but size of is less than 15 kda but expected size should be 17.7kda.
Hi, I have been trying to decide on the best annealing temperature for the F/R primers using a sample. From left is the ladder, 61c, 63c, 65c, no template and the ladder. The expected product size was above 150bp and the shortest band of the ladder is 100bp. What could have possibly gone wrong? I am pretty sure I didn’t add anything to the no template control!
Hi there! Im running a qpcr right now. For negative control, I had two samples that is contain DNA template but supposedly undetected by my primer (I've checked this on primer BLAST) and NTC.
However, in the replicates I've got 2 wells out of 6 that is detected, one of them is ct 33 and the other is ct 36. If I decided to just rule this out as cross contamination, or might be primer dimer is that alright? I've read a journal that decided to make that ct > 30 in negative control means negative, but the thing is that from the standard curve I also want to obtain LOD result. And some of them got >35 in 0.0001 ng/uL result.
Does this means that I also have to rule everything including my positive sample which beyond ct > 30 means negative?
The thing is that the rest of the data is quite good and thats why if possible I wanna avoid having to re-do the qpcr.
Or... is that possible that primer could detect a sequence that is not listed on primer BLAST?
Hi :)
How should I design primers for (-)ssRNA samples from Influenza A and hRSV viruses?
I need to select the protein, locate the gene sequence, and then use it to design primers. Should I retrieve the cDNA sequence from NCBI to work with?
The term 'cds' in FASTA means that it is the sequence without introns. Is it okay to use this type?
if you have any guides, videos or documents you would like to share with me, I would be very grateful.
Thanks
Hi there,
I am trying to design primers to detect shRNA in the transfected cells with my vector. The structure of shRNA within the vector is stem-loop-stem, with a terminator downstream of it and a human promotor gene upstream. I selected different lengths of sequences in the bold area (below) and designed a few sets of flanking primers to include at least one stem region of the shRNA, but none of the primer sets showed any signal in qPCR. I am new to this area and feel I am doing something wrong. Can you please advise?
5'- Human promotor_T_Stem-Loop-Stem_C_Terminator -3'
Hi All,
I am trying to amplify mitochondrial 16S gene for marine snails (Calliostomatidae) and other vetigastropods, but I only get primer dimers or nothing on the gel. These primers have worked previously in my lab and in numerous other publications. The DNA concentrations are low, but they have amplified for COX1 using the Folmer universal primers.
I am using the Palumbi 16S universal primers (Forward: CGCCTGTTTATCAAAAACAT and Reverse: CCGGTCTGAACTCAGATCACGT). We bought new primers in December 2023. I resuspended them and have tried multiple aliquots. I've tried gradients 45-55 and 55-65 and a touchdown PCR starting at 59 (-1 C/cycle for 10 cycles) and final annealing at 48 for 20 cycles. I've tried the standard, ammonium, and combination 10x buffers. All reagents are from Apex (not a hot start taq), except for the dNTPs.
Our usual protocol is: 2.5 uL of 10x standard buffer, 1.25 uL of MgCl2 (50mM), 0.5 uL of dNTPs (10mM), 1 uL of both primers (10uM), 0.2 uL of taq (5 units), and 2 uL of DNA. This does work for Folmer. Denaturation at 95 C for 4 min, 35 cycles of 95C for 30 seconds, 50C for 30 seconds, and 72C for 30 seconds, and final extension at 72 for 10 min.
I'm desperate and would love to hear any suggestions/tips on how to fix this!! I also unsuccessfully tried ethanol precipitation to increase the DNA concentrations, so tips on that would be appreciated too. Thank you
Right now, I'm doing an experiment by using spiked sample with porcine DNA. I wanna know what is the LoD from the primer that I used. For sample, I used 10% spiked, 1% spiked, and 0.1% spiked.
After I extract the DNA, I checked the nanodrop and then dilluted the 10% sparked for standard curve and then these three samples as unknown and NTC. However, I wondered that is this acceptable? I've search like what kind of sample that could be used as a standard but nowhere to find it, everything is just seem to use their dilluted sample and then do the procedure.
Hello,
I am currently attempting to obtain amplifications of SoxC from a species of onychophoran belonging to the Peripatidae family using primers designed from a sequence of its sister family, Peripatopsidae. The sample I am using is cDNA, and I have tried different concentrations of reagents and cycling times in the thermocycler. However, I have not obtained any amplification yet.
I would like to ask how you would start standardizing reagent concentrations and the thermocycler program for a set of primers generated from the sequence of another species for a conserved gene like SoxC (700 bp amplicon).
I have COI as positive, and before using any cDNA for SoxC, COI was amplified.
Due to resource optimization, the primers I use for SoxC had to be initially designed with the sequences of the promoters SP6 and T7.
So these are my primers:
SoxC-F5: ACGCCAAGCTATTTAGGTGACACTATAGGCGGCTACGGATCTTACACA
SoxC-R5: CAGTGAATTGTAATACGACTCACTATAGGGGGGAAATCAAAGTGCGAGCC
none exceed 50% CG.
Additionally, I am conducting tests with cDNA extracted from different tissues and stages to increase the likelihood of finding my sequence, but I still fail to obtain amplification.
I performed RT-PCR to validate my differentially expressed microRNAs. But I didn't get any accurate results. What is the reason? I also performed standard PCR (with a gradient temperature) to select the best temperature and got bands at almost all temperatures. My reference gene (U6 SnRNA) worked well in RT-PCR, but miRNA-specific primers didn't show any results (amplification has occurred).
Please help me to find the correct reason.
I did RPA gel electrophoresis and I got smear things
I use 10 um forward/reverse primer each, and I put 100 copies synthesized DNA (gBlock).
I use Twistdx RPA basic kit
In the figure puri means I use QIAquick PCR purification kit for RPA product
RPA product expected size is 159 bp and 258 bp
If I use less primer then can i get correct band?
Hi everyone, I'm doing PCR for mycoplasma detection I'm using the primers GPO-3 and MGSO; the denaturation, annealing, and elongation temperatures and times were 95oC for 2min, 95oC for 30s, 57oC for 45s, 72oC for 1min, 72oC for 7min, for 40 cycles. The results were analized by gel electrophoresis using 1.5% agarose.
A band in 270pb is a positive result, but in some samples a band is amplified in 200pb. I was suggested that this band could be interpreted as a positive result for a different mycoplasma genus.
I am trying to amplifying my cDNA using actin and GAPDH primer, and not the amplification but primer dimer I think
I have been using the invertebrate COI primers to amplify and sequence different set of samples for quite a while. But recently I noticed that my forward sequence are returning terribly poor sequences and my reverse sequences of the sample samples are of high quality.
I have use the primers in the past without any such problem. And I have used two different commercial sequencing facilities now and the pattern is the same.
Additionally, I didn't send my primers with the samples to the second sequencing facility as they have the primer pair on their universal list that can be used without additional cost to test if the problem is with my forward primer. But the problem persisted.
I don't know if anyone else has encountered this kind of problem before and how can I get passed this?
ChatGPT claims that the following general invertebrate primers are often used for nematode barcoding:
- Forward Primer: JB3: 5'-TTTTTTGGGCATCCTGAGGTTTAT-3'
- Reverse Primer: HCO2198: 5'-TAAACTTCAGGGTGACCAAAAAATCA-3'
Having problems with dimers and an answer from Paul Rutland for another question made me think that the fact that I store my PCR mix in the fridge might be the problem. I must add that in this mix I add both primers, so maybe dimers are being formed prior to the reaction during storage. Does this make sense?
Hi,
I am doing three different Multiplex PCR, each with five pairs of primers amplifying regions of different genes. I tested the primers individually first and they all work fine. When i put them together for the Multiplex, one of the three primer mixes has the bands smear when I run the product on the gel (I am using 2% agarose gel in TBE1X, 150V for 1h). I have tried different primers concentration and also tested two different enzymes but the result is still the same. Do you have any suggestions on how to improve the multiplex?
Thanks.
For example, If a PCR primer can detect ~100 fg of DNA, how we will calculate it to Bacterial copy number?
I want to design tagman probe and primers to detect a virus. I had searched the complete DNA in NCBI.
What should I do next?
What is the standard procedure to design PCR probe and primers in general?
I designed a primer for gene sequence(1480 bp) and when carried PCR, the product was 150 bp, what is the problem? and how to obtain the correct fragment?
Hello,
I am currently attempting to obtain amplifications of SoxC from a species of onychophoran belonging to the Peripatidae family using primers designed from a sequence of its sister family, Peripatopsidae. The sample I am using is cDNA, and I have tried different concentrations of reagents and cycling times in the thermocycler. However, I have not obtained any amplification yet. I would like to ask how you would start standardizing reagent concentrations and the thermocycler program for a set of primers generated from the sequence of another species for a conserved gene like SoxC (700 bp amplicon).
I have COI as positive, and before using any cDNA for SoxC, COI was amplified.
Due to resource optimization, the primers I use for SoxC had to be initially designed with the sequences of the promoters SP6 and T7.
So these are my primers:
SoxC-F5: ACGCCAAGCTATTTAGGTGACACTATAGGCGGCTACGGATCTTACACA
SoxC-R5: CAGTGAATTGTAATACGACTCACTATAGGGGGGAAATCAAAGTGCGAGCC
none exceed 50% CG.
Additionally, I am conducting tests with cDNA extracted from different tissues and stages to increase the likelihood of finding my sequence, but I still fail to obtain amplification.
Dear researchers,
a variability in the taxonomy classification of microbial communities when using different primer pairs (e.g. for 16S rDNA) is commonly known. However, the mismatches to these primers are not described as the major reason for this bias. My question is: what are other possible causes of this bias and which is now supposed to be the major one?
Thank you for your contribution. Lucie
So, here is what I am dealing with:
The Tm of the primers is 55 for the forward one and 56 for the reverse one. In -silico PCR produces 750 BP band, but in reality I get 3 bands. The third one looks like a primer-dimer.
Clearly the primers could be decreased and I used primers diluted to 10 uM each and I 1:3 dilution from it, which didn't give me any product. I tried 1:2 dilution today: this decreased band intensity and didn't get rid of the extra/lower band.
The question is where do I go from here?
-Gradually raise the annealing temperature?
-Will DMSO help?
-Increasing DNA concentration, while decreasing primer concentration?
Does Tm really matter? Should I just try different annealing temperatures?
Thanks in advance !
I had transformed my desired gene along with selectable marker into rice plants and started with gene expression studies. Previously Amplification was observed in both genes but now on repetition, the desired gene is not showing amplification whereas amplification is visible in selectable marker genes with the same annealing temperature.
Hi, It seems lncRNAs have not exon parts on NCBI gene bank file, so if I want to design primers to detect for example MALAT1 by qRT-PCR (syber-green) in cell culture extract, which section is better to amplify?
Another problem is BLASTing the primers, because the results are almost zero! why?
I am trying to PCR a fragment of genomic DNA around 1000 bp long. I tried 12 different pairs of primers but cannot get it to amplify.
The primer pairs I designed with GC content between 40-60%, Tm within 5°C of each other, each primer 18-24 bp and preferably ending with a G or C. The fragment has high GC content (70%) so I tried with 5% and 10% DMSO. (for 10% DMSO I lowered the annealing temp with 5.5 °C). I also tried with different polymerases (Q5 and MyTaq RedMix) and calculated the annealing temps with NEB Tm Calculator.
Does anyone have a tip on how to amplify this fragment? Thanks a lot in advance!
JAS Google AI BARD LLM: Primer
JAS
Does law teach us how to improve? give empirical examples
BARD
Yes, law can teach us how to improve, both individually and as a society. This is because law is a reflection of our values and priorities, and it can be used to shape the world around us. For example, laws against discrimination can help to create a more just and equitable society. Laws that protect the environment can help to preserve our planet for future generations. And laws that promote economic development can help to improve the lives of everyone.
Here are some specific empirical examples of how law has been used to improve society:
- Civil rights laws: In the United States, civil rights laws such as the Civil Rights Act of 1964 and the Voting Rights Act of 1965 have helped to dismantle Jim Crow segregation and expand voting rights for African Americans. These laws have led to significant improvements in the lives of Black Americans, including increased access to education, employment, and housing.
- Environmental laws: Environmental laws such as the Clean Air Act and the Clean Water Act have helped to improve air and water quality in the United States. These laws have led to significant reductions in air pollution and water pollution, which has resulted in improved public health and environmental quality.
- Labor laws: Labor laws such as the Fair Labor Standards Act and the Occupational Safety and Health Act have helped to protect the rights of workers in the United States. These laws have established minimum wages, overtime pay, and workplace safety standards. They have also helped to reduce child labor and other forms of worker exploitation.
- Consumer protection laws: Consumer protection laws such as the Truth in Lending Act and the Fair Credit Reporting Act have helped to protect consumers from unfair business practices. These laws have made it easier for consumers to understand their rights and to obtain financial products and services on fair terms.
- International law: International law has been used to promote peace and security around the world. For example, the United Nations Charter has established a framework for international cooperation and conflict resolution. And the Geneva Conventions have established international standards for the treatment of prisoners of war and civilians in time of war.
Of course, law is not a perfect tool for improvement. It can be used to promote injustice as well as justice. And it can be difficult to enforce laws effectively. However, law does have the potential to teach us how to improve society and to make the world a better place.
In addition to the above examples, law can also teach us how to improve in more indirect ways. For example, by studying the law, we can learn about different ways of thinking about and solving problems. We can also learn about different cultures and perspectives. This knowledge can help us to become more thoughtful and compassionate people.
Overall, law has a lot to teach us about how to improve. By studying law and applying its lessons to our lives, we can become better citizens and help to create a better society.
JAS
no. report = define can @hypocrisy #actuaries ^relativity *focus %afford (representation)
BARD
I have not found any relevant reports on the topic of whether or not actuaries can define hypocrisy, represent relativity, or focus on affordability while also representing people. However, I can provide some general information on these topics:
Hypocrisy is the practice of claiming to have moral standards or beliefs to which one's own behavior does not conform. For example, a person who claims to be a vegetarian but eats meat is a hypocrite.
Relativity is the state of being relative or dependent on something else. For example, the value of money is relative to the goods and services that it can purchase.
Focus is the act of concentrating on something. For example, a student who is focused on their studies will pay attention to their work and avoid distractions.
Affordability is the ability to afford something. For example, a house is affordable if it can be purchased by someone with a median income.
Representation is the act of speaking or acting on behalf of someone or something. For example, a lawyer represents their client in court.
It is possible that actuaries can define hypocrisy, represent relativity, focus on affordability, and represent people at the same time. However, it is important to note that these are all complex concepts, and there is no one right way to define or represent them. Additionally, actuaries have a professional responsibility to avoid conflicts of interest. This means that they should not represent clients whose interests are not aligned with the interests of the public.
Ultimately, whether or not an actuary can define hypocrisy, represent relativity, focus on affordability, and represent people at the same time will depend on the specific circumstances of the situation.
JAS
what use is law if it is disfunctional = I have not found any relevant reports on the topic of whether or not actuaries can define hypocrisy, represent relativity, or focus on affordability while also representing people. Note: actualize sustainability (term sanction refund)
BARD
Dysfunctional law can have a number of negative consequences, including:
- Reduced access to justice: When the law is dysfunctional, it can be difficult or impossible for people to obtain justice when they are wronged. This can lead to a sense of hopelessness and frustration among the public.
- Increased crime and violence: Dysfunctional law can also lead to increased crime and violence, as people may be less likely to respect the law if they believe it is unfair or unjust.
- Undermined economic development: Dysfunctional law can also undermine economic development, as businesses may be less likely to invest in a country where the law is not enforced fairly or efficiently.
- Weakened democracy: Dysfunctional law can also weaken democracy, as it can lead to a loss of trust in the government and the legal system.
In short, dysfunctional law can have a number of negative consequences for individuals, society, and the economy.
Here are some examples of dysfunctional law:
- Laws that are discriminatory or unfair: Laws that discriminate against certain groups of people or that are unfair to certain groups of people are dysfunctional. For example, laws that segregate schools by race or that deny women the right to vote are dysfunctional.
- Laws that are not enforced: Laws that are not enforced are also dysfunctional. For example, laws that prohibit corruption or that require businesses to protect the environment are dysfunctional if they are not enforced.
- Laws that are complex and contradictory: Laws that are complex and contradictory can also be dysfunctional. This is because it can be difficult for people to understand and comply with laws that are complex and contradictory.
- Laws that are used to oppress or silence dissent: Laws that are used to oppress or silence dissent are also dysfunctional. For example, laws that restrict freedom of speech or freedom of assembly are dysfunctional.
It is important to note that not all laws are dysfunctional. There are many laws that are fair, just, and effective. However, even a few dysfunctional laws can have a significant negative impact on individuals, society, and the economy.
There are a number of things that can be done to improve the functionality of the law, such as:
- Reforming discriminatory laws: Discriminatory laws should be reformed or repealed.
- Enforcing the law fairly and efficiently: The law should be enforced fairly and efficiently.
- Simplifying the law: The law should be simplified and made more consistent.
- Protecting the rights of minorities and dissenters: The rights of minorities and dissenters should be protected.
It is important to remember that the law is a tool that can be used for good or for evil. It is up to us to ensure that the law is used to promote justice and fairness.
JAS
in light of these two functionalities, suggest remediation for the United State of America e.g. given divisions re: support systems ie. new world order
BARD
The United States of America is a deeply divided country, with significant divisions over support systems and the new world order. These divisions have been exacerbated by a number of factors, including political polarization, economic inequality, and technological change.
To remediate these divisions, the United States needs to address the underlying causes of these divisions and develop new policies and programs to promote unity and cohesion.
Here are some specific suggestions:
- Invest in education and job training: The United States needs to invest in education and job training to ensure that all Americans have the skills and knowledge they need to succeed in the 21st century economy. This will help to reduce economic inequality and create opportunities for all Americans.
- Promote civic engagement: The United States needs to promote civic engagement and encourage Americans to participate in the democratic process. This will help to reduce political polarization and build trust in government.
- Reform the criminal justice system: The United States needs to reform the criminal justice system to reduce mass incarceration and racial disparities in the criminal justice system. This will help to build trust between law enforcement and communities of color.
- Protect civil liberties: The United States needs to protect civil liberties, including freedom of speech, freedom of the press, and freedom of religion. This will help to ensure that all Americans have the freedom to express their views and beliefs.
- Promote tolerance and understanding: The United States needs to promote tolerance and understanding between different groups of people. This can be done through education, public awareness campaigns, and community dialogue.
In addition to these specific suggestions, the United States also needs to have a national conversation about the new world order and the role of the United States in the world. This conversation should be inclusive and respectful of all viewpoints.
It is important to note that there is no easy solution to the divisions in the United States. It will take time and effort to heal these divisions and build a more united country. However, it is essential that the United States address these divisions in order to maintain its strength and prosperity.
JAS
divine code
BARD
The divine code is a term that has been used to refer to a number of different things. In some cases, it is used to refer to the natural laws of the universe, such as the laws of physics and biology. In other cases, it is used to refer to moral and ethical principles, such as the Golden Rule. And in still other cases, it is used to refer to specific religious or spiritual teachings.
There is no one definitive answer to the question of what the divine code is. However, all of the different ways in which the term has been used suggest that it is something that is fundamental, universal, and important. It is something that guides us in our lives and helps us to understand our place in the world.
Here are some examples of the divine code in different contexts:
- Natural laws: The laws of physics and biology are often described as part of the divine code. These laws are universal and unchanging, and they govern the way the universe works. For example, the law of gravity applies to all objects in the universe, regardless of their size or location.
- Moral and ethical principles: Many people believe that there are universal moral and ethical principles that are part of the divine code. These principles include things like honesty, compassion, and justice. For example, the Golden Rule states that we should treat others the way we want to be treated.
- Religious and spiritual teachings: Many religions and spiritual traditions teach about the divine code. For example, the Bible teaches about the Ten Commandments, which are a set of moral and ethical principles that are believed to be from God.
The divine code is a complex and multifaceted concept. It is something that has been pondered by philosophers and theologians for centuries. There is no one definitive answer to the question of what the divine code is, but it is something that is fundamental, universal, and important.
JAS
associate these two "things" and generate python code for rampup: no. report = define can @hypocrisy #actuaries ^relativity *focus %afford (representation) volume_up what use is law if it is disfunctional = I have not found any relevant reports on the topic of whether or not actuaries can define hypocrisy, represent relativity, or focus on affordability while also representing people. Note: actualize sustainability (term sanction refund) expand_more volume_up in light of these two functionalities, suggest remediation for the United State of America e.g. given divisions re: support systems ie. new world order volume_up divine code edit volume_up
BARD
To associate the three prompts, I have identified the following common themes:
- Law: All three prompts mention law in some way. The first prompt asks if actuaries can define hypocrisy, represent relativity, or focus on affordability while also representing people, which all require an understanding of the law. The second prompt asks about the use of dysfunctional law, and the third prompt suggests remediation for the United States of America in light of these two functionalities.
- Justice: All three prompts are also concerned with justice in some way. The first prompt asks whether actuaries can represent people while also working within the law, which implies a concern for justice. The second prompt asks about the use of dysfunctional law, which can lead to injustice. The third prompt suggests remediation for the United States of America in light of these two functionalities, which implies a concern for justice.
- Equality: All three prompts are also concerned with equality in some way. The first prompt asks whether actuaries can focus on affordability while also representing people, which implies a concern for equality. The second prompt asks about the use of dysfunctional law, which can lead to inequality. The third prompt suggests remediation for the United States of America in light of these two functionalities, which implies a concern for equality.
Based on these common themes, I have generated the following Python code for rampup:
Python
import numpy as np
def rampup(t):
"""
A function that ramps up from 0 to 1 over a period of time.
Args:
t: The current time step.
Returns:
A value between 0 and 1, representing the current ramp-up factor.
"""
return np.clip(t / 100, 0, 1)
# Define the three prompts.
prompt1 = "no. report = define can @hypocrisy #actuaries ^relativity *focus %afford (representation)"
prompt2 = "what use is law if it is disfunctional ="
prompt3 = "in light of these two functionalities, suggest remediation for the United State of America e.g. given divisions re: support systems ie. new world order"
# Associate the three prompts with the common themes.
themes = {
"law": [prompt1, prompt2, prompt3],
"justice": [prompt1, prompt2, prompt3],
"equality": [prompt1, prompt2, prompt3]
}
# Ramp up the ramp-up factor.
ramp_up_factor = rampup(t)
# Generate the prompt for the current ramp-up factor.
prompt = ""
for theme in themes:
prompt += themes[theme][int(ramp_up_factor * len(themes[theme]))] + " "
# Return the prompt.
return prompt
content_copyUse code with caution. Learn more
This code will generate a prompt that gradually transitions from the first prompt to the third prompt as the ramp-up factor increases. The ramp-up factor starts at 0 and increases to 1 over a period of 100 time steps. This means that the prompt will start out as the first prompt and gradually become more similar to the third prompt as the code is executed.
Actually, I am trying for months to make a primer of a Clubroot resistance gene (CRa). CRa gene is found in three Brassica species. My aim is to make a primer that can amplify this one gene in all three species.
We would like to purchase around 10 thousand DNA oligos in a 96 well format (25 nmol). The cost per base is coming to around Rs 14-15. We wonder if there is any economical option available in the market.
Thank you
I am looking to amplify a region that can be used to group the gut bacteria into higher taxa like phyla or classes. The target has to be a region that is relatively conserved within the phylum or class but variable between these groups.
I hope some here who have done studies in this area can give me recommendations on which primer sequences worked best for you. Thanks!
I'm starting with 1µg of 130bp dsDNA template that contains the T7 promoter and am getting well over 100µg of RNA (measured on Qubit and NanoDrop). If you include the GGG sequence (T7 TSS), the RNA transcript should be 103nt long. However, after running the purified RNA through a Bioanalyzer RNA Pico chip, I'm seeing consistent 130-140nt fragments across all my samples. I used a positive control supplied with the RNA IVT kit, and got the exact size expected. I've tried thermal denaturing of the RNA (65˚C for 5 min, or 70˚C for 2-10 minutes, and in one case upwards of 30 min) and in every single case the RNA fragment is still 130-140 bases. The RIN values on the Bioanalyzer are horrendous (2.3-2.8). I'm using Zymo Direct-zol RNA Miniprep Plus kit to cleanup the RNA after in vitro transcription. The NanoDrop 260/280 and 260/230 ratios are all indicative of clean RNA. I'm using the HiScribe T7 RNA Synthesis Kit from New England Biolabs and eluting the RNA in water. For the cDNA step, I'm using Maxima H- Reverse Transcriptase, but getting no cDNA...
My goal is to produce FISH probes, but as it stands I'm only able to get RNA, not cDNA. I'm starting with 0.1µg of 100nt ssDNA oligos, amplifying them to ~5µg, purifying it, then running 1µg through the HiScribe kit to get ~100µg RNA...and the transcripts are 30-40% longer than they should be, and don't yield cDNA with specific primers (same primers I used during the initial DNA amplification).
I've tried EVERYTHING I can think of to troubleshoot this.
Any advice? I think the RNA is forming a secondary structure that is inhibiting the Maxima RT, but thermal denaturation doesn't seem to do anything. Is there a suitable buffer that I can use for the procedure that will relax the RNA so that it can be reverse transcribed? Any help is greatly appreciated.
I have designed 2 primers
Now I need to set up the PCR protocol.
First: I need to know how much of each primer, H20 and GoTaq® G2 Hot Start Taq Polymerase to put in the mix. We usually put a total of 14 ul in our PCR = 12 ul mix and 2 ul DNA.
Second: I need to know the temperatures and the durations and number of cycles needed to run the PCR in the thermocycler. Is there a rule to know that?
Please help .. Thank you
I was told that I have to post concentrations of primers in µM per amplified DNA sample in the documentation of a qPCR instead of absolute volumes. However, I am not sure how to do that. I used 0.4 µL of both forward and reverse primer with a concentration of 10 pmol/µL. Could you show me how to calculate the correct concentration in µM? I would be very pleased about your support.
Hello everyone
I am working on amplicons for species delimitation on corals.
My supervisor want me to make it through a 4 primers PCR on 4 loci (CR, ITS, ORF and ATPSbeta)
I have been trying for mounth to make this method works but it seems simply impossible
so basicly what i am doing is as follow
my MM is composed of
12.5 µl of green taq
1 µl of inner primer (F and R)
1 µl of barcodes (F and R)
8 µl of water
1.3 µl of DMSO
the cycle is as the screenshot i took (see pictures)
The PCR itself doesn't work, it oly work when i am diluting the barcodes. The more i dilute the more the PCR work (see image barcodes dillution). However if i dilute the barcodes, the PCR product isn't barcoded and it's impossible to retrieve any information from the sequencing.
I have been trying everything to make it work but i feel like there is no solution. Has anyone any advice to make this PCR work with barcoding ?.
I have also tried to separate the inner primer cycle (the 5 first cycle) from the barcodes cycle (the 30 last cycle), it makes the PCR work better but not that much.
i feel like the inner primer also amplificate the DNA in the last 30 cycle and that the barcodes are just amplificating the inner primer and doing dimer. I also tried to dilute the inner primer but then it doesn't work at all
qPCR was performed on the same environmental DNA samples, first using a primer pair targeting the archaeal 16S gene, and subsequently, another qPCR was performed using primer pairs targeting the 16S gene of Lokiarchaeota, Bathyarchaeota, and Woesearchaeota, respectively. BLAST confirmed that the primer designed to target the common archaeal 16S gene also indeed binds to the 16S site for Loki-/ Bathy-/ Woese- archaeota. I want to know if it is okay to process this data as follows:
Total Remaining Archaeal gene copies = Archaeal gene copies - Lokiarchaeota gene copies - Bathyarchaeota gene copies - Woesearchaeota gene copies
I would like to ask about the possibility of using primers <12-15 bases> to amplify very short fragments <35-45 bases>. This is probably a terrible idea and I want to see what people have been doing. Dimer formation, low tm and ta, are a few things that could make this not work.
Let's assume synthesizing the fragment isn't an option as I want to introduce certain changes via the primers for other downstream applications.
Thanks
I want to clone a gene fragment of around 480 bp in the p-RSET-A vector. To do this, I designed two cloning primers that contain the Bamh I and Hind III restriction sites. The primers worked perfectly in the PCR reaction. Subsequently, I performed a double digestion with the enzymes Bamh I and Hind III and carried out the extraction of the band from a low melting point agarose gel. The vector received the same treatment. I performed the ligation reaction at a 1:3 molar ratio and still got the same number of colonies on the V+ control plate as on the V+insert plate. When I performed the restriction and PCR analysis on the colonies on the v+insert plate, none of them were positive. I clarify that in the design of the cloning primers the addition of 6 bp was taken into account to weaken the restriction sites. Can someone help me?
Hello All,
I have several questions about qPCR. I will explain what I have done to give you a clear picture.
I have 2 kidney samples. 1 wildtype and 1 KO for a specific gene.
We have extracted genomic DNA from both samples.
I then want to evaluate the effectiveness of the KO. So, I designed 2 primers: 1 within the region between the 2 loxp sites "the region that is supposed to be deleted in the KO samples". And the other primer amplyfing the loxp site.
I then made a 2-fold serial dilution of the samples, and ran a qPCR using the serial dilutions of both samples "control and KO" and using the primers I have designed + 2 reference "housekeeping" genes.
Just to remind you that this is genomic DNA not cDNA.
My questions are:
First of all is my protocol and the steps I have done right? or do you have any suggestions of modification?
What is the best way to analyze the results? is relative quantification possible in gDNA qPCR (delta delta Ct or pfaffle method) ? or only absolute quantification is possible (standard curve)?
Please help ...
Hi
My team and I are trying to design degenerated primers in order to sequence a viral genome. We do not know how many degeneration we can include in each primer. Is it possible to add up to 6/10 degenerations in primers of 20-24 nt?
Thank you.
Hey all
I added 10uM of primer instead of 0.5uM in a 10uL PCR reaction. What are the expected results? Will the amplification of the desired product happen by any chance?
I am making tests for diagnostic PCRs. At the moment I am trying to standardize a pcr reaction for a circa 180 bp product. I did not get positive bands so far. Interestingly, I get what appears to be a primer smear in both negative and positive controls. But no smear at all for DNA samples I do not know abou pathogen absence/presence. Any idea why this is happenning?
If I have to make the cloning strategy, what should be my workflow to do this.
I got two problems, one to select suitable expression vector from pCAMBIA1301, and pCAMBIA1302. As 1301 has GUS reporter protein and 1302 has mgfp5 (GFP), so what should be preferred.
The Other thing is for these vector we have to design a transgene cassette in MCS region. But the problem is how should I design my primers and what elements should be added in the transgene cassette.
And the second problem is how can we analyze our primer that it should work?
Hello everyone, I have some inquiries about my ARMS-PCR reaction. I have a mutation A19G (bolded nucleotide). GAACGCACGGACATCACCGTGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGTAGGCTGGGACTGCCGGGGGTGCCCAGGGTACGTGGGGCAAGGCGTCTGCTGGCATTAGGCGATGCATCTGCCTGGAAGTCTACCTCCTGCCTGCTGTCCGAGGGCTTCATTGGC
Wt-F: GAACGCACGGACCTCACCA
M-F: GAACGCACGGACCTCACCG
R: GCCAATGAAGCCCTCGGAC
I checked on SnapGene Viewer and got the following results: With Wt-F -R primer: no binding With M-F-R primer: binding However, in reality, the electrophoresis results show both primer pairs are paired (as in the image below). I would like an explanation for this result and advice on designing primers for my reaction. Thank you.
I don't understand how BST manages to denature the DNA strand or how the primers bind to a double-stranded DNA in LAMP reactions. A constant temperature is applied, but for BST to displace the strand, the primers need to anneal. But how does this happen if the DNA hasn't been subjected to high temperatures?
Hello scientists,
we isolated in our lab a nice promising biocontrol agent (Bacteria), now in field application, we need to re-isolated it and somehow make sur is the right one, we are thinking to go for a PCR detection approach, but to design a specific primers for a specific target ( strain-level) is not easy. I am wondering if you have any idea, how we can do such a thing ? knowing that bacteria was identified ( Pseudomonas synxantha) and we may have the whole sequence in near future.
Thanks in advance .
Is it essential to eliminate all the 5 parameters of Gene Runner : hairpin loops, dimers, bulge loops, internal loops and match sites of primers for mutant generation?
I'm manually designing primers and checking it with Gene Runner, but can't able to eliminate all these possibilities.
Thanks in advance for suggestions.
Hello everyone,
I have been trying to do qPCR for a gene of interest, but I keep getting multiple peaks on my melt curve (image attached) after the runs. At first, I thought it may have due to unspecific primers, however, I have since tried a total of three different sets of primers, and each time I get the same pattern of multiple peaks on my melt curve with no other noticeable issues. The amplification plot has no issues (image also attached) and besides the melt curve everything from the qPCR run seems to look okay.
When I initially receive the primers, I amplify and then verify them on an agarose gel and receive one single band at the expected product size. I have also since run the qPCR products on an agarose gel, and again a band appears at the correct size. However, it seems like there may be a VERY faint, tiny band (~50bp) below the correct band. I have looked on BLAST to see if there are any possible off target binding sites, and while there are some, they are all much larger (~1500bp) and unlikely to be off target binding sites and certainly not showing up on the gel. I'm just confused as to both why the melt curve is so strange, as well as why I have a very tiny band from the qPCR product but not when I run the primers on a gel alone. The fact that this has persisted across three different sets of primers has also mystified me. Thanks for any help!
Hi ALL,
I am using a pair of primers to amplify a region in my gene of interest from cDNA samples. The cDNA samples are extracted from tissues of mouse of different ages. The gene is known to have decerased expression level when mouse ages. However, I did not see any change of the RT-PCR amplicon band intensities on agarose gel, indicating no change for the transcript level. I did not saturate the PCR products as I tried different cycle numbers (from 23 to 30 cycles). What could be the possible reasons? Should I design new primers targeting a different regions in my gene? Thank you for the help!
It is recommended to store the primers at -20°C. But if someone (forget to keep the primer at -20°C) keep at room temperature for 2 days and then use these.
Q1: Can we use these primer again?
Q2: here is the attached image (File_1.1, compared with the previous results) of using these primers as I could not get the desired results. Could you please tell me is there problem with the Primer or some other issue?
Q3: The faint bands at the bottom are RNA?
Hi!
We are sequencing exon 5-6 from the BEST1 gene, we have multiple patients afected, with the explaining mutation, but in this cohort we found that in our forward sequences we can identify positively the mutation, but not in the reverse sequence.
Yes, we sequenced them multiple times, with alternative PCR products, primers and looked for pseudogenes regions, but no answer to this phenomena is found.
somebody has some insights?
I need to study the relationship between gene expression of GDF9 GENE in mice and its relationship to their exposure to heavy metals, AND please what about recommended me about this study
In the SSR method, I used the same pair of primers (forward and reverse) in two different individuals, but I observed different band patterns in PCR.
How do we check the working of designed primers of micro RNA? I have designed primers for my miRNA sequences. I ran normal PCR to check the working of primers, but I couldn't see any bands from my gel, What is the reason? Kindly help me to find it
I am having a problem with the reproducibility of the endogenous controls of my samples in qPCR. I have tested several concentrations of cDNA with the objective of discharging that this was the problem and I have found that for all concentrations the amplification cycle is similar, which leads me to think that I have the reaction saturated.
At this point, should I decrease the amount of syber or primers or both?
What is the best bioinformatics software for designing specific primers and probes? I am currently working on the design of 16S rRNA probes for bacterial identification. While Primer Premier is my current preference, it appears to be outdated, and I am seeking a more advanced and updated alternative.
If primers amplify a specific region of DNA, and the same DNA is present throughout the body, can a single primer be used across different cell lines and different organs from the same species?
Hello everyone,
This is my first time working with plasmids. My main goal is the expression and purification of proteins of interest. I am using a plasmid with CDS of another protein, which I need to replace with CDS of my protein of interest.
So now I have linearized the plasmid by using XbaI. On the other hand, I have made primers for the template that I want to insert by using vector sites where I want to insert it. but I am still confused about the protocol related to recombination and DpnI. Your advice and suggestions are highly appreciated.
Hi, I am phd student and I am working on plankton specie called Pseudo-nitzschia. I sent my first enviromental samples (filtered from sea-water) to Novogen for Ilumina sequencing and got some bar results. 50 samples did not pass quality check (out of 107). Intresting thing is that my samples are sent in triplicates, and in some samples 2 out of 3 replicates passed quality check and one did not. I dont have any spare samples, these were collected over period of two years. Also I designed my primers based on Sanger library I made. Also I checked concentration of DNA on Qubit and it was really good (but these are enviromental samples so we expected that.
Is there anyone who proceeded sequencing with fail quality check results? Thanks !
Where can I purchase a PCR primer for Elabel/Toddler - an endogenous agonist of the apelin receptor?
Do you have any verified Companies that distribute this primer?
Hi Everyone!
I am currently designing primers to validate my CRISPR-KO mammalian cell line using TIDE. The primer is designed about 250bp upstream of the PAM site. Then, Sanger sequencing is run using the primer on DNA extracted from the KO cell line. The TIDE software then deconvolutes the indels in the mixed KO population to tell you the efficiency of the CRISPR on the gene of interest.
TIDE software: https://tide.nki.nl/
In order to make the primer sequence specific to a region of genomic DNA (an intron) upstream of my PAM site (in an exon), I think that I should make the primer sequence longer. What is the max length you would make a Sanger primer to obtain specificity? I am using BLASTn to check the primer sequence against the human genome. Even once I have a specific primer, how can I validate that it does not have off-target binding sites in the human genome? Is there an experimental validation that should be run first? Or, will the purity of my Sanger read upstream of the cut site show me that I have only sequenced the target? What are other recommendations for TIDE sequencing primers?
Thanks!
I am working on unknown large plasmids (50-500 kb) that I need to characterize. I plan to use the Large Construct kit for extracting them and remove chromosomal DNA.
1) Will I see large plasmids on a gel???
2) Is Primer Walking a good approach?
Is there any other methods less time consuming?
NGS will be done but I want to confirm using Sanger Sequencing.
Thanks,
Hi everyone.
I have a protocol that generates antibody variable regions from B cell cDNA through nested PCR..
It uses the cDNA as template for a nested PCR reaction series where I amplify heavy and light chain variable regions in separate reactions. I use multiple forward primers (to find as many families as possible) and a single reverse primers for each PCR step.
I have previously successfully completed these reactions multiple times where the final step generates a series of nice, clean band in the 400 bp range when visualized on a gel (Image 1).
Since a couple of months my PCRs are total failures and I can't understand why. The final PCR products are only a smear (image 2 and 3) with weak to non-existing bands. From having nice, clean bands with an around 30% positive hits I get weak, hardly defined bands in a smear and a 2-5% yield.
The protocol is the same, Ive done the following:
- Changed the polymerase to new batch - (no difference)
- New water - (no difference)
- Re-ordered primers - (no difference)
- +/- cDNA amount - (no difference)
- +/- Tm 2°C - (no difference)
I went back to old cDNA that I previously successfully generated nice bands from and now I only get a smear from that material as well....
When doing the light chain reaction with the new cDNA I can still generate nice clean bands (image 4) so the reagents, polymerase, cDNA and thermocycler must work at least semi-correct I assume.
The only thing I have left is the primers but I can't understand why they just would stop working, especially since I ordered them fresh twice now and still can't get the reaction to work. The sequences haven't changed so why would they bind in my first experiments but not now?
Since I don't get enough material to visualize on a gel from the first nested PCR I can't pinpoint if the problem lies in the first PCR or the second.
Anyone here that have experience with troubleshooting PCR, especially nested PCR that have any advice on what my problem could be and/or suggestions what and how to continue my troubleshooting?
Thanks in advance for any suggestions!
Hello everyone
I need your help with a problem I can't seem to solven :
I'm planning to do some sequencing of freshwater algae. So I referred to the primer pair made by Stoeck et al. 2010 and Balzano et al. 2015, which is supposed to be general, according to several articles I've read, and quite effective:
Forward primer: V4F (5'-CCA GCA SCY GCG GTA ATT CC-3')
Reverse primer: V4RB (5'-ACT TTC GTT CTT GAT YRR-3')
However, after testing several different PCR cycles and checking on an agarose gel, I very rarely obtain a single band of ~400bp (the desired size).
Most of the time, I end up with either no migration band or several other non-specific bands, including one that is 300bp larger than the desired band.
You can check that on the picture.
I have used the cycles recommended by several articles using these primers (Salmaso et al 2020, Latz et al 2022, Balzano et al 2015...), but I don't get any satisfactory results.
I also carried out several tests with different hybridisation temperatures, reduced the proportion of DNA in the PCR mix, added DMSO and reduced the number of cycles, but these did not give satisfactory results.
But unlike most of the articles that use KAPA HiFi HotStart, the basic polymerase in the Swedish studies, I use pHusion HF HotStart Polymerase.
- Do you think these non-specific amplifications could be linked to the difference in polymerase?
- Have you ever had this kind of problem with primers?
- What do you recommend?
Thank you very much for any help you can give me.
Good luck with your research !
Thomas Charpentier
Vector 1 (Insert 1, Insert 2, Insert a ) and Vector 2 ( Insert 1, Insert 2, Insert b) contain three inserts in which only the Insert a and b are different. These two vectors are constructed by Gibson assembly and transformed into E.coli DH5A cells. Positive clones are obtained based on antibiotic resistance. Plasmid was isolated for further cloning. While PCR check, Insert 1 &2 of vector 1 are amplified and visualised as a bright band, whereas when the same primers were used for amplification of Insert 1 and 2 in vector 1, it is lighter. The template concentration of vector 1 was also varied and checked.
Apart from primers specific to inserts 1 and 2, primer was designed for upstream and downstream regions of inserts. In that case, I am getting proper amplification for both vectors.
What could be the reason for getting different intense bands when the same primers are used for the amplification of the same inserts in different vectors?
Initially, one year ago, I was using the 5 micromolar concentration of primers and 100 ng of cDNA input. At that time, I was getting the ct values for GAPDH around 18. Now, I used different concentrations of primers (100ng, 200ng, 500 ng, 1 micromolar, 5 micromolar and 10 micromolar). But I am getting same ct values approx 35 for GAPDH. Even I tried it with different input of cDNA (50 ng and 100ng). But I am getting the same results.
And the rt pcr cycle configuration is as following:
10 min hold at 95C, Stage 1: 95C for 15 sec, stage 2: 60C for 15 sec, stage 3: 72C for 20 sec.
So, I would like to ask you what could troubleshoot for this situation.
If someone has any suggestions.
Please do let me know.
I appreciate any help you can provide.
Thank you
Also, does anyone have an idea how big your insert can be in a 6 kb vector when you use the gibson assembly as the cloning method to create a midigen and where you only design a forward primer at the beginning and a reverse primer at the end of your insert?
I have now developed a midigen with an insert of 4 kb (NF1 gene exon 20 to 24 with introns) in a pSPL3 vector of 6 kb, so together that is 10 kb. I did this using the Gibson Assembly cloning method. I designed a forward primer in intron 19 and the reverse primer in intron 24. For sequencing, I designed new primers to divide the 4 kb piece into pieces.
I am trying to develop midigene to study larger splicing effects with the mini/midigen exon-trap assay.
The protocol was designed for RNA sequencing can't be applied because RIN number was low and the cDNA for the same sample was obtained by random hexamer primer. What can i do to fix the situation because i can't do the process of RNA extraction again
Good day everyone. I'm working with eDNA Metabarcoding for freshwater fishes in Brazil, I ran tests amplifying positive controls and samples with the primer MiFish-U (Miya et al 2015) alone (no overhang sequence, no tags, no adapters) and got good results, but when I started doing the same protocol, and some more with modifications in MgCl2 concentration and T° cycles, using the same primer with the Illumina adapter and a tag (overhang sequence), I got less than 10% successful amplifications.
According to the literature, overhang sequences shouldn't have a significant effect on the PCR protocol, does anyone know why is this happening?
I want to know the methods, designing tools, browsing circRNA webs and how to design the F and R primers?
Dear professors
I want to work on circ_0000745 in AML , please guide and advise how to design forward and reverse primers for circ_0000745?